1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helga [31]
3 years ago
15

The olfactory bulbs of the sheep ___. a. located more superiorly then humans b. are less important as a food getting sense then

humans c. are relatively larger than humans d. carry visual information
Biology
1 answer:
Setler [38]3 years ago
3 0

Answer:

The correct answer is c. are relatively larger than humans.

Explanation:

The olfactory bulbs of the sheep are two or three times larger than humans, and therefore, they provide them a greater sense of smell, which in their case, is indispensable for surviving. This serves them for finding food, as well as finding their babies and other things.

You might be interested in
Heres the text
maks197457 [2]

Answer:

GO WITH YOUR GUT :)

Explanation:

8 0
2 years ago
Read 2 more answers
Sandra believes that alien beings on unidentified flying objects (UFO’s) are beaming thoughts into her head. She is suffering fr
Vinil7 [7]

Answer:

C) a delusion

Explanation:

Anyone you would talk to would say that this is not possible while Sandra believes it true so therefore it is a delusion.

8 0
2 years ago
Read 2 more answers
1. In addition to mechanical and chemical digestion of food, the stomach's other major function is: carbohydrate and nucleic aci
Alenkasestr [34]

Answer: Food storage

Explanation:

Stomach is a small pouch like structure which has the ability to store food temporarily.The storage of the food temporarily takes place in the stomach. The food that we eat reaches to the stomach by the help of food pipe.

Here, the food is stored until it is completely broken down into simpler form and enzymes act on them.

The food is then absorbed in the small intestine. But before this food is temporarily stored in the stomach where all the digestive juices and enzymes come to act on the food.

6 0
2 years ago
Read 2 more answers
Compare the shapes of the organisms that have cell walls with those that do not have cell walls.
inna [77]
The best answer is A. The purpose of the cell wall is to hold the cell in a specific shape, usually rectangular or square. For example, a plant cell's wall keeps it rigid so that the plant can stand up. 

If the cell does not have a wall, it can easily change shape to accommodate for things coming in and out of the cell. 

Hope this helps!
5 0
3 years ago
What type of cell would have a nucleus but no cell wall
nata0808 [166]
An animal cell has a nucleus but no cell wall.
3 0
3 years ago
Other questions:
  • During intense (heavy) exercise, the ability of oxidative phosphorylation to provide enough ATP for force generation by the skel
    7·1 answer
  • Which is produced by the endocrine system to control how cells and organs function?
    8·1 answer
  • A woman gives birth to a son who has type A blood. She has type AB blood. Which of the following can be concluded from this abou
    13·2 answers
  • I need help please help me
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • And comparing a desert to on Mars which statement is not true
    13·1 answer
  • When two species occupy the same niche in an ecosystem, the result of the competition is that one species will either have to mo
    6·1 answer
  • Era
    15·2 answers
  • 1-A rock that contains evidence of past animal or plant life is called a
    9·1 answer
  • The grizzly bear is a mammal, belonging to phylum Mammalia and kingdom Animalia. It belongs to the genus Ursus and the species A
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!