1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
otez555 [7]
3 years ago
10

The movement of a bone around its longitude axis

Biology
1 answer:
sattari [20]3 years ago
6 0
Rotational movement is the movement of a bone as it rotates around its longitudinal axis.
You might be interested in
Which disease produces too much of mucus?
miss Akunina [59]
In the disease "<span>cystic fibrosis" the lungs get filled with too much mucus.</span>
5 0
3 years ago
Read 2 more answers
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
PLEASE HELP!!!!!!!!!!!!!!!!!!
ValentinkaMS [17]
So I see at least three answers here that could potentially be correct, however I believe the best possible answer would be D. they distribute heat around the planet and are a major factor influencing the climate around the globe. 

(The other two possibly correct answers would be A. and B. Animals such as Sea turtles will use the ocean currents as a means of quicker transportation and navigation. Sailors would also use the currents as a means of quicker transportation and navigation, however that is not required today with modern technological advances.)<span />
8 0
3 years ago
Read 2 more answers
An organism starts growing out of the parent organism. It may or may not remain attached to the parent organism. Which type of a
Ugo [173]
The answer is budding. Hope this helps. : )
5 0
3 years ago
What is photosynthesis​
atroni [7]

Answer:

plants make food with the help of sunlight, water n air is called photosynthesis

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • What is NOT an impact that an invasive non-native species has on an ecosystem?
    12·2 answers
  • A patient has recently been diagnosed with an acoustic neuroma. the nurse helps the patient understand that:
    10·1 answer
  • Archaebacteria use _____ for movement. celia flagella pili cell walls
    11·2 answers
  • Alligators, crocodiles, and snakes are all reptiles. However, alligators are more closely related to snakes. Which statement MOS
    11·2 answers
  • 6.
    12·2 answers
  • What are some closely related animals to the Marine Iguana?
    14·1 answer
  • What is parent material?
    8·1 answer
  • What gives a sea squirt it's unique structure and shape?
    12·1 answer
  • Explain the relationship between the environment, variation, and selection.
    9·1 answer
  • Select the correct answer. in cellular respiration, where do the high-energy electrons that move through the electron transport
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!