1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
3 years ago
14

The lymphatic system is responsible for transporting what to the blood stream

Biology
1 answer:
GREYUIT [131]3 years ago
3 0
Lymph nodes or plasma
You might be interested in
Can someone help me with question 2 please
Daniel [21]

Answer:

As the stomach gas

Explanation:

7 0
2 years ago
Homeostasis is controlled by: (give examples of each)
kramer

Answer:

Homeostasis is controlled by the nervous and endocrine system in mammals

Explanation:

Nervous system when you touch a hot pan the nervouse system sends a message to move or feel pain

Endocrine system releases hormones into the bloodstrram that helps our growth and development,helps our organs work metabolism,and reproduction

Hope this helps!

8 0
2 years ago
Prior to the 1600s it was believed that all living things were either plants or animals. Which of these inventions led to the de
maksim [4K]
<span>The invention of the microscope led to the development of a much more detailed classification system. Prior to the microscope, we believed the only life was life that we could visually see with the naked eye. However, with the invention of the microscope we were able to see that more life is contained in a small droplet of water than there are people on earth. It was eye-opening!</span>
3 0
3 years ago
Which category are usually classified by
Klio2033 [76]
Can you explain the question a bit more too me? Idk I don’t understand it:)
6 0
2 years ago
Use what you have read to summarize Jackie Robinson’s story in two or three sentences.
Ilia_Sergeevich [38]

Answer:

Jackie Robinson’s story is the story of struggle, motivation and courage.

Explanation:

Jackie Robinson is base ball player in the baseball team of America. He was the first African who played in the American team. At that time racial superiority at its peak due to which their teammates hurts him with words and with physical action but he did not lose his temper and focus on his game which make him a hero in his team. He was the name of struggle, motivation and courage. From his story, many people inspired and make their life better.

4 0
3 years ago
Read 2 more answers
Other questions:
  • True or False: Skeletal muscles are found in the heart
    15·1 answer
  • Speculate on how higher sea-surface temperatures (sst) might impact earth's greenhouse effect.
    10·1 answer
  • Which of the following is an antimalarial drug that is thought to increase ROS levels in target cells?
    9·1 answer
  • One effect of air pollution is destruction of
    12·1 answer
  • Maria wanted to grow a fern in her backyard. Acting on a suggestion from a friend, she collected brown dots from the underside o
    5·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which ancient culture is not know for using geothermal energy?
    13·2 answers
  • What is a mixture in which all the components are evenly spread out?
    12·2 answers
  • Which of the following is a molecule?<br> A. Argon<br> B. Water<br> C. Nitrogen<br> D. Uranium
    6·1 answer
  • Explain why climate change is having a bigger impact now than it has in the past.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!