1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
3 years ago
14

A constant rate of increase (rmax) for a population produces a growth graph that is J-shaped rather than a straight line. Why?

Biology
2 answers:
Alexus [3.1K]3 years ago
7 0

Answer:

Explanation:

The line graph illustrates the temperatures in London, New York and Sydney on monthly average and the table introduces the information about the annual hours of sunshine for these cities. The overall view is that London is always exceeded by the rest in both the temperature and the number of sunshine hours.

To specify, the line graph shows that in New York, the average temperature goes up slightly from 4.5 degree in January to 8 degree in March, before a more significant increase to the highest of 30 degree in July, followed by a drop to 5 degree in December. Similarly, in London, after climbing gradually from the lowest point of 9 degree to the highest of 23 degree in July, the figure stays unchanged in the next month and then fall to 9.5 degree in December.

On the contrary, in Sydney, the temperature decrease insignificantly from 25.5 degree in January to the lowest of 16 degree in July, before a gradual rise to 25 degree in December. Meanwhile, the table indicates that New York has the largest number of sunshine hours per year with 2535 hours, came after by Sydney and London with 2473 hours and 1180 hours respectively.

In conclusion, London is likely to be the coldest city because its annual hours of sunshine is less than two others.

d1i1m1o1n [39]3 years ago
4 0

Answer:

Because the growth rate is constant, that is, the population is constantly growing and not stagnant.

Explanation:

The J-shaped growth graph occurs because the population is changing size (growing) as this population has a constant rate of increase. If the population was stagnant, it was neither increasing nor shrinking in a given size. time interval, the chart would have a line shape.

In other words, we can say that at a constant rate of increase, the population is growing steadily, causing a displacement of the line presented by the map that takes the form of J.

You might be interested in
A gyre is _____.
butalik [34]

Answer:

A

Explanation:

Gryes are know as spirals or vortexs, especially in the oceans

8 0
3 years ago
Examples of monosaccharides disaccharides and polysaccharides.
RUDIKE [14]

Answer:

Glucose, galactose, and fructose are common monosaccharides, whereas common disaccharides include lactose, maltose, and sucrose. Starch and glycogen, examples of polysaccharides, are the storage forms of glucose in plants and animals, respectively. The long polysaccharide chains may be branched or unbranched.

Explanation:

3 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
A plant can have either broad leaves (B) or narrow leaves (b). A plant with genotype Bb is crossed with a plant with genotype bb
pentagon [3]
C if you look at the square you can see that b b =bb and not Bb
4 0
2 years ago
Read 2 more answers
Help me Please!!!!!!!!!!!!!!!!! I will mark correct answer as brainliest!
nydimaria [60]

Answer:

atlanta i think

Explanation:

In this case the reference point is Atlanta, this is where the family started their motion from. Such that this point may be used to describe their movement. It is sued to describe their movement to Baltimore.

5 0
2 years ago
Other questions:
  • Why should the lateral sides of the infant's heel be used for capillary puncture?
    14·1 answer
  • Many scientist believe that dinosaurs became extinct due to
    6·2 answers
  • What organelle is labeled M?
    11·2 answers
  • Complex chemical catalysts produced by living cells are enzymes.
    10·1 answer
  • Which kind of organism is an autotroph? consumer producer decomposer herbivore
    10·2 answers
  • If the cambium of a particular plant was damaged, what would be the most likely effect on the plant?
    11·1 answer
  • Explain the evolutionary relationship between the fin of a fish and the flipper of a whale.
    14·2 answers
  • Please answer ASAP (:
    8·1 answer
  • What is the name of the sheath that encases axons to protect them and increase the speed of communication between neurons?
    8·2 answers
  • Suppose Stephen breeds flowers and wants to optimize production of offspring with both short stems and white flowers, which are
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!