1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stira [4]
3 years ago
10

Which of the following statements correctly distinguishes between an acidic and a basic solution?

Biology
2 answers:
zepelin [54]3 years ago
5 0
The correct option is A. 
A basic solution has a high concentration of hydroxide ions more than any type of ion and that is why it is basic in nature. An acidic solution has a higher concentration of hydrogen ions and that is why it is acidic in nature. A neutral solution has equal amount of hydroxide and hydrogen ions. Solutions are usually classified as either basic or acidic based on their hydrogen ion concentration.
stellarik [79]3 years ago
5 0

Answer:

a

Explanation:

i took the test

You might be interested in
The most common type of electronic evidence is
Gre4nikov [31]
Email bc its most used
8 0
3 years ago
List three reasons why homeostasis in the body might be disrupted
Ahat [919]

homeostasis is a set of self-regulation we can figure out what this means, One could be that we need homeostasis to maintain a balance, but if we receive any news it may affect homeostasis.

7 0
2 years ago
What are the synergist muscles that help the triceps brachii???
rosijanka [135]
The triceps brachii muscle is the large muscle on the back of the upper limb of many vertebrates. It is the muscle principally responsible for extension of the elbow joint.
3 0
3 years ago
The ph of your stomach must be (a)more than 7 (b)basic (c)equal to 7 (d) none of the above
marysya [2.9K]

Answer:

(d) None of the above

Explanation:

The pH of your stomach must be highly acidic, because the optimum pH for pepsin, the chief stomach enzyme, is 1.5.

(a) and (b) are wrong, because both conditions are basic.

(c) is wrong, because pH 7 is neutral.

5 0
2 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
Other questions:
  • The arrows in the chart above represent the movement of carbon between four reservoirs: the ocean, plants, fossil fuels, and the
    9·1 answer
  • The carbon in coal, oil, and natural gas come from
    12·2 answers
  • "interpret the diagram"
    5·1 answer
  • Most pneumonia infections are caused by a virus or bacteria. What characteristic could scientist use to distinguish an infection
    7·1 answer
  • How did the reintroduction of wolves into Yellowstone park return the stability to the Yellowstone ecosystem
    8·1 answer
  • Please answer the question on the picture
    5·1 answer
  • What bill will have to be paid one of these days
    6·2 answers
  • A virus has entered your body through the air. You are coughing, and have a runny nose, and are running fever. 1. Idenitify the
    8·2 answers
  • Genes are made of _ which carry the directions for inheritance from their parents
    7·1 answer
  • Please help! Its for a grade and im confused.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!