1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
3 years ago
5

You are treating a​ 36-year-old female patient who was involved in a motor vehicle crash. she was not wearing a seatbelt. a byst

ander states that the patient was initially unconscious at the scene before your arrival. there is no apparent external trauma aside from a bruise on the front of her head. is this a patient who should have a​ high-priority transport?
Biology
1 answer:
Minchanka [31]3 years ago
6 0
She was unconscious before the incident so something must have happened before it, also the bruise could result in brain damage.
You might be interested in
Describe the following interms of water cycle<br> (energy sources)<br> (carrier of nutrients)
PIT_PIT [208]

Answer:

Of the many processes involved in the water cycle, the most important are evaporation, transpiration, condensation, precipitation, and runoff.

Explanation:

1. The conversion of liquids into gas is termed

as Evaporation.

2. The conversion of Gas into liquids is called

Condensation.

3. The falling of water droplets in the form of

rain after condensation of clouds is called

Precipitation.

4. The cyclic exchange of water into its different

stages is called Water Cycle.

5. The amount of water vapor present in the

atmosphere is called the Humidity.

3 0
3 years ago
NEED AN ANSWER ASAP NO LINKS
bija089 [108]

Answer:

Explanation:

1.  both DNA and RNA

2. guanine

3. cytosine

4.DNA

5. RNA

3 0
3 years ago
Which statement BEST describes a herbivore?
timofeeve [1]
The correct answer is an animal the consumes plants
5 0
3 years ago
Read 2 more answers
1. If the primers shown below were used in a DNA analysis of person 1.2 and 3, what order would the bands appear, from top to bo
wlad13 [49]
080p,try this if it’s wrong my bad
6 0
3 years ago
Suppose you were going to use the design process to build the tree house you designed.whst more would you need to do before you
Tanya [424]
Well, obviously one would need to start off with a plan. After having an idea/blueprint of what your ideal treehouse will look like try finding some measurements for the wood (or whatever material you will use I won't judge) of course you better already have the length, width, and height of your treehouse. After that, you can get building; which could take days or even weeks depending on the house design and the amount of people you have to help out. Once that's done you can paint and decorate it all you want. (of course, to get it in the tree you might need a pulley to put it up there or build the bottom up on the tree.) And all your missing your ladder and that's it.
8 0
3 years ago
Other questions:
  • While sitting in class, sherman suddenly experiences a racing heart, clammy hands, dizziness, and shaking. sherman has many of t
    9·1 answer
  • Plants alter their generations by switching between _______ phases.
    12·2 answers
  • Ash trees are being removed when they show signs of the ash borer, a parasite that affects the trees and kills them off. What be
    6·1 answer
  • Anaerobic respiration produces a maximum of ______ ATP per glucose.
    11·1 answer
  • A type of forest characterized by trees that seasonally shed their leaves is referred to as a __________.
    15·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Jaydyn ran 5000 meters from the cops and a average speed of 6meters/second before she got caught. how long did she run
    15·1 answer
  • i need help on this question im getting behind every second this is confusing i NEED ANSWERS please and thank you​
    6·2 answers
  • Question 8 of 10<br> Which question can be answered using the scientific process?
    11·2 answers
  • What process is the opposite of condensation ?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!