1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
13

- The part that is responsible for regulating involuntary processes in the body.

Biology
2 answers:
Ipatiy [6.2K]3 years ago
5 0

Answer:

Your medulla oblongata is located at the base of your brain, where the brain stem connects the brain to your spinal cord. It plays an essential role in passing messages between your spinal cord and brain. It's also essential for regulating your cardiovascular and respiratory systems.

I think its b ????. Sorry if it is wrong.

Explanation:

Mazyrski [523]3 years ago
3 0

Answer:

I am just in jss 2 but I think the ans is d

You might be interested in
Of the total amount of glucose energy consumed by the body each day, about what percentage is used by the brain and nerve cells?
Alexeev081 [22]

Of the total amount of glucose energy consumed by the body each day, about 20% is used by the brain and nerve cells.

The brain constitutes about 2% of the total body but it is one of the main consumers of energy derived from glucose.

The energy provided by glucose is used for the proper functioning of the brain. It generates ATP which is an energy source that is responsible for r neuronal and non-neuronal cellular maintenance and generates neurotransmitters.

Thus glucose-derived energy is critical for the health of the brain. Lack of energy can cause several brain diseases.

If you need to learn more about glucose energy, click here

brainly.com/question/11653058?referrer=searchResults

#SPJ4

4 0
2 years ago
9. Which two subatomic particles make up the nucleus of an atom?
Alona [7]

Answer:

<h3><u>Protons & Nucleons</u> are the 2 subatomic particles make up the nucleus of an atom.</h3>

Explanation:

7 0
3 years ago
The Clean Water Act funded the creation of which of the following?
attashe74 [19]

Answer:

Sewage Treatment Plants

Explanation:

Just did the test sorry its so late man.

6 0
3 years ago
Read 2 more answers
Compare and contrast the structure and function of a compound light microscope and a scanning electron microscope. Be sure to di
Artyom0805 [142]
<span>Basically both operate by bouncing tiny particles or waves off of objects in order to make them visible. Electrons are smaller than light photons so we can see smaller objects clearly with electron microscopes. There are disadvantages though. First, color is a function of light wave frequency so we can't see electron micrographs in color. Color can be added artificially though by computer to differentiate structures, (think photoshop). Also, we cannot see electrons so we make them visible by bouncing them off a cathode ray screen similar to a TV set or computer monitor</span>
6 0
3 years ago
Scientists are testing the effect of different scrubber technologies on the removal of pollutants from coal power plants. The sc
sladkih [1.3K]

Hello. This question is incomplete. The full question is:

"Scientists are testing the effect of different scrubber technologies on the removal of pollutants from coal power plants. The scrubbers use a slurry of limestone and water. Which of the following best describes the impact of modifying the slurry by increasing the amount of limestone? The amount of sulfur dioxide released will decrease. A The amount of ground-level ozone released will decrease. B The amount of water released will increase. C The amount of carbon monoxide released will increase. "

Answer:

The amount of sulfur dioxide released will decrease.

Explanation:

As you may already know, coal is a fossil fuel and burning it releases many toxic gases into the atmosphere, including sulfur dioxide.

A suspension of water and limestone, allows the calcium present in limestone to enter into reaction with sulfur dioxide, forming calcium sulfide and decreasing the emission of sulfur in the atmosphere.

The greater the amount of limestone in this suspension, the less sulfur dioxide will be released into the environment.

7 0
3 years ago
Other questions:
  • A scientific law explains why or how certain events or patterns happen true or false
    9·2 answers
  • Which of the following is not evidence for the law of conservation of mass during cellular respiration?
    7·1 answer
  • An organism will survive if it is adapted to its environment. what is the name for this process apex
    10·1 answer
  • Bacteria in the phylum ________ occur as elementary or reticulate bodies depending on their life cycle stage, are obligate intra
    12·1 answer
  • All annelids and arthropods have
    15·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the correct classification of 18x?
    13·1 answer
  • How is a recessive allele different from a dominant allele?
    10·1 answer
  • What are three steps doctors would take to repair damaged heart tissue?​
    8·1 answer
  • WH white shoes SOle become plan with time​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!