1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
raketka [301]
3 years ago
15

Which religiously persecuted british colonists left england and formed the first-self government

Geography
1 answer:
valentinak56 [21]3 years ago
5 0

Answer:

Puritans were English Protestants who were committed to "purifying" the Church of England by eliminating all aspects of Catholicism from religious practices. English Puritans founded the colony of Plymouth to practice their own brand of Protestantism without interference.

Explanation:

You might be interested in
How can you tell which fossil is oldest looking by at the layers of the earth
nalin [4]
Whatever fossil is at the lowest layer is the oldest cuz the old fossils lived along time ago and when they died the fossils were buried.
3 0
3 years ago
According to the online content article about using maps, which of the following map elements is used to understand the symbols,
vova2212 [387]
The answer is A. The legend. 

I hope this helps, have a nice day. 
3 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Water power, geothermal and solar power are all examples of a. non-renewable resources used worldwide. c. non-renewable resource
Oxana [17]
Renewable resources used for energy
7 0
3 years ago
Read 2 more answers
The sun's energy comes from
Lyrx [107]
Nuclear fusion because the sun has massive gravity that squeeze hydrogen atoms together and fusing them into helium which releases energy
6 0
3 years ago
Other questions:
  • If the carbon emissions continue to damage the Andes mountain glaciers, the lives of millions of people dependent on the run off
    10·2 answers
  • Tornado alley is most closely associated with
    10·1 answer
  • How would you describe the support Borlaug received from EC Stakman and Coach Dave Bartelma?
    10·1 answer
  • Question1
    13·1 answer
  • How do you determine what makes up a region
    6·1 answer
  • Lily would like to know what countries border the United States. What type of model should she use to determine this?
    14·1 answer
  • Weather is a result of different air masses coming in contact with each other. Use the fronts and pressure systems on the weathe
    13·2 answers
  • How can we put and end all forms of corruption​
    15·1 answer
  • What makes up a majority of the ocean floor worldwide
    14·2 answers
  • Name five formation/shapes created by wave action​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!