Answer and Explanation:
Ribosomes are the primary structure for protein synthesis. They can be found in the rough endoplasmic reticulum or floating in the cytosol.
Free ribosomes are not attached to any cytoplasmic structure or organelle. They synthesize proteins only for internal cell use. Other ribosomes are attached to the membrane of the endoplasmic reticulum and they are in charge of synthesizing membrane proteins or exportation proteins. Free and attached ribosomes are identical and they can alternate their location. This means that although free ribosomes are floating in the cytosol, eventually, they can get attached to the endoplasmic reticulum membrane.
Synthesis of proteins that are destined to membrane or exportation starts in the cytoplasm with the production of a molecule portion known as a <u>signal aminoacidic sequence</u>. This signal sequence varies between 13 and 36 amino acids, is located in the <u>amino extreme</u> of the synthesizing protein, and when it reaches a certain length, it meets the <u>signal recognizing particle</u>. This particle joins the signal sequence of the protein and leads the synthesizing protein and associated ribosome to a specific region in the Rough endoplasmic reticulum where it continues the protein building. When they reach the membrane of the endoplasmic reticulum, the signal recognizing particle links to a receptor associated with a pore. Meanwhile, the ribosome keeps synthesizing the protein, and the enlarged polypeptidic chain goes forward the reticulum lumen through the pore. While this is happening, another enzyme cuts the signal sequence, an action that requires energy from the ATP hydrolysis. When the new protein synthesis is complete, the polypeptide is released into the reticulum lumen. Here it also happens the protein folding (which is possible by the formation of disulfide bridges of proteins are formed) and the initial stages of glycosylation (the oligosaccharide addition).
Once membrane proteins are folded in the interior of the endoplasmic reticulum, they are packaged into vesicles and sent to the Golgi complex, where it occurs the final association of carbohydrates with proteins. The Golgi complex sends proteins to their different destinies. Proteins destined to a certain place are packaged all together in the same vesicle and sent to the target organelle. In the case of membrane proteins, they are packaged in vesicles and sent to the cell membrane where they get incrusted.
There are certain signal sequences in the <u>carboxy-terminal extreme</u> of the protein that plays an important role during the transport of membrane proteins. A signal as simple as one amino acid in the c-terminal extreme is responsible for the correct transport of the molecule through the whole traject until it reaches the membrane.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
<span>A prominence is a bright arched cloud of ionized gas in the chromosphere and corona of the Sun. It is mostly contained in the sun's magnetic field. A solar flare, however, is a ejection of mass from the sun that actually comes in contact with the rest of the solar system.
I think this will help you "</span><span>Think of solar prominence as the Sun stretching out its gas components to a length that can reach thousands of kilometers... solar flares are similar to this only that it snaps at the peak of its stretch... solar prominences are usually harmless... nobody would want a solar flare to happen as this will entail a damaging surge of energy... coronal mass ejections [are] more powerful and therefore more harmful to Earth life..."
Hope I helped you</span>
Seasons occur because Earth is tilted on its axis relative to the orbital plane, the invisible, flat disc where most objects in the solar system orbit the sun. Earth's axis is an invisible line that runs through its center, from pole to pole.
Independent variable would be the thing that changes so the size of the rock
