1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Morgarella [4.7K]
3 years ago
9

Type the complementary strand to the following single-stranded DNA.

Biology
1 answer:
Vitek1552 [10]3 years ago
8 0

Answer: The complementary strand from 5' to 3' is TCAGTAATCGTATGGCCCATGCTAT

Explanation: DNA is a molecule having two antiparallel complementary strands. The two strands are antiparallel because as one runs in a 5->3' direction, the other strand runs from 3'->5' direction. In DNA base pairing, adenine pairs with thymine while cytosine pairs with guanine. The complementary strand of the above strand from 3'->5' is 3'TATCGTACCCGGTATGCTAATGACT5' but the question says the complementary strand should be written 5' to 3', therefore the complementary strand is TCAGTAATCGTATGGCCCATGCTAT

You might be interested in
This type of fermentation makes energy in the form of entirely from this process
KonstantinChe [14]
This type of fermentation makes energy in the form of ATP the process would be glycolysis
8 0
3 years ago
Which choice is considered an integral membrane protein?
svp [43]

Answer:

not sure if this is multiple choice but the answer is a protein with its N-terminus in the cytoplasm and its C-terminus in the extracellular space

6 0
2 years ago
What is the main difference between purines and pyrimidines?
zubka84 [21]
Purines are two ringed structures
pyrimidines are single ringed structures
6 0
3 years ago
As carbon dioxide concentration soar over 400 ppm, what do you expect to see as far as how the earth is responding?
ruslelena [56]

Answer:

The correct answer would be - increase in green house effect, increase in temperature and rise in sea level are some major response.

Explanation:

Carbon dioxide concentration soar over 400 ppm which means there are 400 particles of carbon dioxide in a million particles of air. It is on the highest level of all time from the beginning. Carbon dioxide is a green house gas which means it is able to absorb heat and trap it in air which leads to increase in temperature of the earth.

Increase in earth temperature will lead to melting of ice lands which result in rise of sea level and cities will drown in sea. Other effect will be pollution in atmosphere and warmer climate and change in pattern of climate. There are many other direct and indirect response in accumulation of carbon dioxide concentration.

4 0
3 years ago
Be my valentine? or my best friend? or my best brainly helper? :D
uysha [10]

Answer:

I can be your best friend and best brainly helper :))

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Without this process life would cease to exist because it is the first step in energy transfer from the sun.
    6·2 answers
  • 2. Which type of microscope can produce three-dimensional images of a cell’s surface? (1 point)
    12·1 answer
  • What is the average life expectancy for someone with HIV? Does life expectancy differ around the globe?
    12·1 answer
  • HELP! WILL MARK BRAINLIEST! What differences can you see when you compare the nucleus of a cell in mitosis with that of a cell i
    13·2 answers
  • Which one of the following is a characteristic of a metal?
    14·1 answer
  • Which are the two most important factors determining the movement of ions across the cell membrane?
    6·1 answer
  • The three main functions of the nasal passages are?
    8·2 answers
  • -For a solar eclipse to occur, the sun must be positioned between Earth and the moon.
    15·2 answers
  • What are the structures in the leaves that are unutilized in transpiration? ( pls hurry)
    11·2 answers
  • Evidence of Evolution in the human body?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!