1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Morgarella [4.7K]
3 years ago
9

Type the complementary strand to the following single-stranded DNA.

Biology
1 answer:
Vitek1552 [10]3 years ago
8 0

Answer: The complementary strand from 5' to 3' is TCAGTAATCGTATGGCCCATGCTAT

Explanation: DNA is a molecule having two antiparallel complementary strands. The two strands are antiparallel because as one runs in a 5->3' direction, the other strand runs from 3'->5' direction. In DNA base pairing, adenine pairs with thymine while cytosine pairs with guanine. The complementary strand of the above strand from 3'->5' is 3'TATCGTACCCGGTATGCTAATGACT5' but the question says the complementary strand should be written 5' to 3', therefore the complementary strand is TCAGTAATCGTATGGCCCATGCTAT

You might be interested in
How do plant populations affect predators ?
madreJ [45]
If theres no plants then the animals that eat those plants die then the animal the eats that animal die and so on. Hope this helps!
4 0
3 years ago
a puppy has long floppy ears like his mother and dark brown for like his father how did the puppy get these traits
hammer [34]

Answer:

genes

Explanation:

the puppy got half their mother's chromosomes and half their dad's chromosomes therefore inheriting parts of their genes

5 0
3 years ago
How does the structure of a protein affect the functions of muscle contraction
marshall27 [118]
<span>Since muscle contraction depends on interactions between actin, myosion and some intermediate molecules, the primary protein structure of such proteins and their spatial conformation are fundamental for their functioning. For example, actin and myosin, both filamentous proteins that slide past each other or troponin/tropomyosin interactions that blocks the binding of myosin to actin.</span>
6 0
3 years ago
Within a limited area, if the population of a predator increases, the population of its prey is likely to
Len [333]

The prey is likely to decrease/decline if the predator's population increases

7 0
4 years ago
Which of these will help you keep the information from your notes fresh in your mind?
olganol [36]
Hello

Reviewing over by memorizing them
Flash cards
Quizlet
Kahoot!

These are different way to study

Hope this helps
Plz mark me as brainist
8 0
3 years ago
Other questions:
  • Genetically modified organisms include microbes used in biotechnology that possess enzymes promoting antibiotic resistance. This
    6·1 answer
  • Which of the following statements about cyst formation is true?
    14·2 answers
  • True or false aerobic respiration produces more atp than anaerobic respiration
    13·2 answers
  • Can anyone pls help?!
    11·1 answer
  • Compared to stars viewed with the unaided eye, stars viewed with telescope appear
    9·1 answer
  • What is the similarities between mid ocean ridge and trenches? EXPLAIN GOOD PLEASE
    9·1 answer
  • 22. Pollution can enter and contaminate an aquifer from which of the following?​
    11·1 answer
  • Where do the thickest deposits of terrigenous sediment typically form?
    15·1 answer
  • Write down the utility of yeast and mushroom​
    11·2 answers
  • How does DNA and evolution play a role in modern taxonomy
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!