1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Morgarella [4.7K]
3 years ago
9

Type the complementary strand to the following single-stranded DNA.

Biology
1 answer:
Vitek1552 [10]3 years ago
8 0

Answer: The complementary strand from 5' to 3' is TCAGTAATCGTATGGCCCATGCTAT

Explanation: DNA is a molecule having two antiparallel complementary strands. The two strands are antiparallel because as one runs in a 5->3' direction, the other strand runs from 3'->5' direction. In DNA base pairing, adenine pairs with thymine while cytosine pairs with guanine. The complementary strand of the above strand from 3'->5' is 3'TATCGTACCCGGTATGCTAATGACT5' but the question says the complementary strand should be written 5' to 3', therefore the complementary strand is TCAGTAATCGTATGGCCCATGCTAT

You might be interested in
Match the following terms to their best definition
Tasya [4]
Grain roundness goes to grain size , sediment sorting goes to loss of edges ,layering goes to stratification of sediments and rocks , texture range of particle size . hope this right!
3 0
4 years ago
Read 2 more answers
Why is it so hard to please people
Lyrx [107]

Answer:

Because, people are all different and their tastes and what they dislike can change very rapidly. In a shorter version people are very variable.

Explanation:

3 0
3 years ago
Read 2 more answers
Which type of rock can only form on or very near Earth's surface?
GrogVix [38]
Sedimentary Rock (hope I could help)
6 0
4 years ago
Read 2 more answers
Why would birds rather have seeds than bread
Novosadov [1.4K]
Birds are Oviparous animals, they have small uterus (portion where child grow in viviparous animals), just due to that, they lay seeds than breed

Hope this helps!
7 0
4 years ago
Why are the large finches now living on the galápagos islands different from the original source population from a nearby islan
Softa [21]

Answer:

The reasons are explained below -

Explanation:

The large finches living on the Galapagos islands are different from the original source population from a nearby islands because of the following reasons -

  • A natural selection favored only the large finches because they are more fit to the current environmental conditions.
  • A genetic drift has been occurred in the two populations living on the nearby islands.
  • Due to the separation of habitat on both the islands, the gene flow between the two islands is reduced.

All the above listed reasons are responsible for the difference in the finches found on the two islands.

3 0
3 years ago
Other questions:
  • WILLL GIVE A BRAINLEST AND 20PTS
    14·1 answer
  • What is the perihelion?
    7·2 answers
  • Some batería have _______ or whiplike tails the spin to propel them forward
    5·1 answer
  • Why did the U.S. become involved in Afghanistan?
    12·1 answer
  • All of the following are changes seen in the respiratory system with aging, except
    5·1 answer
  • Why each part of the cell cycle is important?
    12·1 answer
  • Help!!Quickk!!!!!!!!!!!!
    7·2 answers
  • According to the endosymbiotic theory, which cellular process was involved in the evolution of mitochondria and chloroplasts?
    10·1 answer
  • Describe the structure of the study independent variables , dependent variables and detail why the researchers would have used r
    14·1 answer
  • Second exposure to the pathogen
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!