Answer:
They are know as heterozygous alleles.
Explanation:
Two IDENTICAL alleles are known as homozygous<em> </em>alleles.
I hope this helps you understand the difference, and as always, I am joyous to assist anyone at any time.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Hi there!
By both unity and diversity in life, it means that animals and plants (and ecosystems) can be very different from each other but they can also have very similar characteristics. They can work together in harmony but become predator and prey at the same time.
Hope this helps!
Since there is no sequal to GATTACA, they basically just leave it up to your imagination to come up with the rest.
This same cinematic logic was put into place with the movie, "The Client". At the end, you are left you imagine for yourselves what you wish happens.
I hope this helped! Have an amazing day :)