1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babymother [125]
3 years ago
9

Which type of climate is most beneficial to soil formation?

Biology
1 answer:
IgorC [24]3 years ago
5 0

Answer:

Your answer is A, Rain forest.

Explanation:

Soils develop faster in warm, moist climates and slowest in cold or arid ones. Rainfall is one of the most important climate factors in soil formation.

I hope that helped ,let me know if you need help with anything else

You might be interested in
What processes turn sediment into sedimentary rock?
Mice21 [21]
         The processes that turns sediment into sedimentary rock is the compaction and cementation of sediment. Hope this helps!
4 0
3 years ago
Read 2 more answers
What are three reasons why<br> deforestation is occurring?
alexdok [17]
Hot temperatures, natural disasters, agriculture, urbanization, etc.


Mark me as brainliesttttt !!
6 0
3 years ago
The distance from Earth to the Sun is 1.0 _____.
goldfiish [28.3K]
The answer is 1 astronomical unit
7 0
3 years ago
What conclusion can be reached about this data
Over [174]

Answer:

Explanation:

What data?

5 0
3 years ago
The chief commanding officer during the Vietnam War was _____. General Calley General McNamara General Westmoreland General Pete
jasenka [17]
General Westmoreland was the chief commanding officer during the Vietnam War. After his tenure Creighton Abrams took over. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • Ken enjoys bird watching. Every summer, he sees many ruby-throated hummingbirds in his garden. However, during the winter, he ne
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The competitive exclusion principle states that two organisms cannot fill similar niches.
    13·2 answers
  • John and Pat are identical twins with identical DNA. John works in a movie theater, and Pat works as a lifeguard. They have very
    9·2 answers
  • What part of the sweating process promotes cooling?
    11·2 answers
  • Forensic anthropologists note that if we separate all of humanity into three groups (white, black, Asian), there are common trai
    9·1 answer
  • a patients heart muscle fibers are relaxed and the heart is filling with blood. This phase is called what
    13·1 answer
  • Why is the media we use to grow bacteria get damaged?​
    6·1 answer
  • As rocks break apart, the overall surface area will
    13·1 answer
  • What organelles do both prokaryotic and eukaryotic cells contain?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!