1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
4 years ago
5

اين تقع قارة اسيا و قازة افريقيا

Geography
1 answer:
Finger [1]4 years ago
8 0

Asia is located in the northern and eastern parts of the globe. Suez is the region between the African and Asian continents, not only Suez but also the Red Sea

You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
True or False
DIA [1.3K]

Answer:

  1. TRUE
  2. TRUE
  3. TRUE
  4. FALSE
  5. TRUE
  6. TRUE
  7. FALSE
  8. TRUE
  9. FALSE
  10. TRUE

Explanation:

1) Topography is a major challenge  hence answer is TRUE

2) Forecasts made for shorter periods tend to be more reliable and accurate when compared to forecasts made over a longer period hence answer is TRUE

3) pre-frontal squalls lines are linked to thunderstorms answer is TRUE

4) It is easier to forecast the potential of a blizzard than the movement of a tornado  FALSE

5) A tornadic waterspout is a Tornado over a body of water ; TRUE

6) Hurricanes require high relative humidity concentrations ; TRUE

7) A microclimate is the average climate a very small area not as big as a city hence answer is FALSE

8) This is TRUE because the thunderstorm can cause the aircraft to lose its control

9) The eye wall of a hurricane forms only at the final stage of the Hurricane hence the answer is FALSE

10) TRUE

6 0
3 years ago
What is the climate of Central America
Delvig [45]

Answer:

Temperatures in Central America are highest just prior to the summer wet season, and are lowest during the winter dry season, when trade winds contribute to a cooler climate. The highest temperatures occur in April, due to higher levels of sunlight, lower cloud cover and a decrease in trade winds.

HOPE IT HELPS

TAKE CARE

Explanation:

8 0
3 years ago
Answer ASAP Pls<br>will give brainliest to best answer​
Schach [20]

Answer:

1) Mercator Projection

2)the middle part of the grid

3)They are the same map of the world but different because the Robinson Projection youd have a globe, the other one is not a globe it looks to be a flat map.

Explanation:

7 0
4 years ago
Using four or more complete sentences, describe the main characteristics of the highland climate type.what role does elevation p
NARA [144]

Answer:

Highland climates are located high in mountain regions and can be found at all latitudes. The main factor in determining temperature in this type of climate is elevation, not latitude. This consistently cold weather comes from the altitude because as elevation increases, temperature decreases

Explanation:

hope this help :)

6 0
3 years ago
Other questions:
  • The american south is an example of a ____ culture region.
    9·1 answer
  • Choose the geographic theme As a protection from rising sea water caused my hurricanes many houses in Galveston Texas are built
    8·1 answer
  • Which of the following sports has the biggest impact on the people in South America?
    15·2 answers
  • Short Answer
    6·1 answer
  • 7. How might the fleeing of so many refugees impact Syria? (think ESPeN)
    13·1 answer
  • Soru fotoğraf da yardım lütfen
    11·1 answer
  • Why does the dark half of the moon always face away from the sun?
    11·1 answer
  • Do humans face mass extinction? If so How?
    7·1 answer
  • What are some diffrent types of birds?
    10·1 answer
  • 6. Why does the north-east coast of Canada remain icebound during the winter
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!