1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksju [112]
3 years ago
8

Glycine is highly conserved amino acid residue in the evolution of proteins. why?

Biology
1 answer:
adelina 88 [10]3 years ago
5 0

Answer: Glycine has the smallest aspect chain of any amino acid. Its measurement is regularly fundamental in allowing polypeptide chains to make tight turns or to strategy one some other closely.

Explanation:

You might be interested in
An image is shown here where a strand of mRNA is modified by spliceosome activity after it is transcribed. Which statement accur
vazorg [7]

Answer: The answer is B,C,D

Explanation: Because it’s right ;)

8 0
3 years ago
Rank the following in order from most general to most specific: 1. gametic isolation 2. reproductive isolating mechanism 3. sper
mihalych1998 [28]
<h2>Reproductive Method </h2>

Explanation:

<em>The rank in order from the most specific which is following .</em>

<em>(1) Reproductive isolating mechanism</em>

<em>(2) Sperm-egg incompatibility in sea urchins</em>

<em>(3) Gametic isolation </em>

<em>(4)Prezygotic isolating mechanism</em>

<em>(1) Reproductive isolating mechanism-</em> The components of regenerative confinement are an assortment of transformative instruments, practices and <em>physiological procedures basic for speciation.</em> They keep individuals from various species from delivering posterity, or guarantee that any posterity are sterile.

(<em>2) Sperm-egg contradiction in ocean urchins-</em> Bindin is a gamete acknowledgment protein known to control species-explicit <em>sperm-egg grip</em> and layer combination in ocean urchins.

<em> (3)Gametic isolation - Prezygotic hindrances </em>keep preparation from occurring. Gametic disengagement is a sort of prezygotic hindrance where the<em> gametes (egg and sperm) </em>come into contact, yet no preparation happens. Gametes might be not able to remember each other in various species  

<em> (4) Prezygotic isolating mechanism- </em>while postzygotic segregation forestalls the arrangement of rich posterity. Prezygotic systems incorporate environment segregation, mating seasons, "mechanical" disconnection, gamete detachment and conduct seclusion. 

4 0
3 years ago
In pea plants, purple flower color, C, is dominant to white flower color, c. The table shows the frequencies of the dominant and
GuDViN [60]

Answer:

Generation 1: p= 0.60 q= 0.40

Explanation:

Due to technical problems, you will find the complete answer and explanation in the attached file

Download pdf
5 0
3 years ago
Why do we need recycling of carbon?
Step2247 [10]
Helps to reduce pollution in a community
7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • The most heavily colonized human organ by bacteria is the ________, containing 1011‐1012 bacterial cells per gram. large intesti
    9·1 answer
  • How is energy lost from each trophic level?
    9·1 answer
  • White blood cells defend the body from _____.
    8·1 answer
  • What is the role of energy in living Organisms? Is it a more or less important role than other characteristics of life? Defend y
    13·1 answer
  • If you removed all Hawks from an ecosystem what would happen
    7·1 answer
  • In the electron transport chain of the mitochondria, electrons are commonly
    13·1 answer
  • (PLEASE HELP ASAPP!!!!)
    6·2 answers
  • Complete oxidation of one acetyl in Krebs cycle produces 1 ATP by substrate level phosporylation Select one:
    14·2 answers
  • 5. What was Darwin's theory of evolution?​
    5·2 answers
  • In a food chain the flow of energy is Always___.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!