Answer:
B
the trna will not be recognized by trna synthetase and cannot be charged
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
Mar 4, 2011 — Past changes in Earth's temperature happened very slowly, over ... Human activities contribute to global warming by increasing the greenhouse effect. ... Emissions of carbon dioxide, the most important greenhouse gas, ... Even slight rises in average global temperatures can have huge effects. ... 100 years.
Explanation:
Answer:
<u>This is because the Viron has in its genome a specialized code for synthesising any missed enzyme for replication that is lacking in the host cell.</u>
<u>An example is the replication of the human DNA cells by the Immunodeficiency virus(HIV) </u>. Human cells only have enzymes for copying DNA templates, and lacks the enzyme to convert the HIV RNA genome to human DNA.However these viruses have in its genome; code for synthesising its own RNA polymerase enzymes that copies or transcribed the human DNA to HIV RNA.
<u>This ability of the viral cell to code for the host's enzyme has a therapeutic effect</u>. Drugs can be targeted at the viral polymerase enzymes to reduce the replication and therefore toxicity in the host cells.
Explanation: