1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
3 years ago
5

Which organisms develop gills from pharyngeal arches and later develop lungs to breathe on land?

Biology
2 answers:
kondaur [170]3 years ago
8 0

Answer:

The third one

Ghella [55]3 years ago
7 0

Answer:

3rd one

Explanation:

You might be interested in
The white mater is composed of
ratelena [41]

Answer:

The correct answer is option A.

Explanation:

White matter is the component of CNS which consist neuron cell bodies or myelinated cell axons or nerve fiber collectively known as fiber tracts mainly. Glial cells also one of the component of white matter, made up of few sulci and gyri. White matter makes superficial regions of the spinal cord and deep parts of the cerebrum.

The neuron cell bodies of white matter sends signals to neurons and each other. White matter regulates the action potentials function as coordinators in between brain parts.

Thus, the correct answer is option A.

4 0
3 years ago
Which of the following are true regarding ores?
Helga [31]

Answer: its B: I, II, III, and IV

Explanation: i took the K12 test

3 0
2 years ago
Na20
dsp73

Answer:

A)2 sodium atom and 1 oxygen atom

7 0
3 years ago
Read 2 more answers
What are the three<br> parts of the hair SHAFT?
Elodia [21]

Answer:

The hair shaft is comprised of three layers: the cuticle, cortex, and medulla.

Explanation:

7 0
3 years ago
Read 2 more answers
Mo says it was the environment that made them who they are; Jasper says it was because of genetics. Which is it? Construct an ex
bija089 [108]

Answer:

It's the nature vs nurture situation. While the genetics of a person does control the physical traits he/she may develop, the environment also has a major role to play here. For instance, the person may have the genes for developing a tall height. If, however, that person is not provided with the right kind of nutrition and the right time, it is very likely that he/she will not grow as tall as they had the potential for. Similar explanation for non-physical traits.

This is not an 'either/or' type of argument. Genetics and the environment have a collective impact in shaping the person into who they are and while the balance may shift to one side or the other in certain cases, it does not cancel out or negate the other's effect.

Hope that answers the question, have a great day!

4 0
3 years ago
Read 2 more answers
Other questions:
  • The S-P interval of seismic waves recorded at a seismometer is 8 minutes. Approximately how far away is the earthquake’s epicent
    5·2 answers
  • Oraciones con selva
    9·1 answer
  • ¿Qué agencias monitorea estos fenómenos, cuáles son las tares y responsabilidades de estas?
    6·1 answer
  • A species of rose was studied in Florida and was found to have the following distribution in petal color alleles: 70 for the red
    13·1 answer
  • Help on both questions please I’ll give 98 points :)
    8·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How is the function of the mitochondrion important for the role of the ribosome in a eukaryotic cell?
    10·1 answer
  • Which of the following is not a part of the excretory passage?
    15·1 answer
  • Write a paragraph summarizing why this genetic mutation
    8·1 answer
  • A skeletal muscle is a composition of several components bundled one into the other. at which structural level in the muscle doe
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!