Answer:
1 for the first blank and I think 3 for the second blank
here's ur free pic of the day, Charlie! ^^
Answer:
the organelle responsible4 chem energy to ATP, is the mitochondria...
Explanation:
The mitochondria is responsible 4 packaging protein into energy the cells of the body can use 4 energy..
Answer:
Protection from infection known as species resistance is a result of both the absence of necessary receptors and lack of suitable environment in the body.
The correct answer is filtration.
The small molecules can cross in and out of the capillaries through facilitated or simple diffusion. However, the majority of the flow of capillary and tissue fluid takes place through the process of filtration and reabsorption. Filtration refers to the movement of the fluid out of the capillaries and is mediated by the capillary hydrostatic pressure.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
