1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aniked [119]
3 years ago
14

Why bacteria in the soil. are necessary in this ecosystem 8th Grade Science

Biology
2 answers:
liubo4ka [24]3 years ago
6 0
There could be a lot of reasons. To help break down food for the plants, kill off bad and harmful things that might damage the plant. 
kakasveta [241]3 years ago
3 0
Bacteria are important in the soil to maintain the nitrogen cycle. Certain type of bacterais help in nitrogen fixation. They also decompose dead and decaying matter into nitrogen compounds such as ammonia. The nitrogen and nitrogenous compounds in turm help the plant to grow.

When the plant dies, the bacteria again decomposes it into nitrogenous compounds. Not only plants, but also animals. The nitrogen then passes through various stages and then gets back to atmospheric nitrogen. Bacteria is an important part of this nitrogen cycle. 
You might be interested in
What are the similarities between the immortal jellyfish and wolf
ioda
They both hunt for food and will ruthlessly kill you before you can cry, "MAMA!"
4 0
2 years ago
Why would a plant not grow well in green light?
prohojiy [21]

Answer:

green light is not real light plants need the sun which produces real energy

6 0
2 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
Put the following list in order from beginning to end of a food chain.
steposvetlana [31]

Answer:

1-4-2-6-5-3

Explanation:

Hope it helps

3 0
3 years ago
Read 2 more answers
Why is negative feedback often associated with maintaining homeostasis
Ostrovityanka [42]

Answer: Negative feedback serves to reduce an excessive response and to keep a variable within the normal range. Negative feedback loops control body temperature and the blood glucose level.

7 0
3 years ago
Other questions:
  • WILL MARK BRAINLIEST FOR CORRECT ANSWER WORTH 25
    13·1 answer
  • A woman becomes pregnant. Which of the following is the best thing she could do for her baby?
    6·2 answers
  • Is a short, fleshy stem surrounded by enlarged, fleshy bases of leaves.
    7·1 answer
  • Explain why Huntington disease is caused by a dominant allele.
    15·1 answer
  • Question 4: Here is a picture of Mr. Dacy's family. Given what you know about genes
    7·1 answer
  • Why is a hydrothermal vent precarious for life to exist?
    5·1 answer
  • ANSWER ASAP!
    14·2 answers
  • where does the electron transport chain get the high-energy electrons that are passed down the chain​
    11·1 answer
  • Draw two snapshots, take a photo, and attach the photo here. 1) Draw a 2n=6 cell undergoing anaphase 2) Draw a 2n=6 cell undergo
    11·2 answers
  • Epigenetics may be defined as changes in the expression of a gene or set of genes by _______ and _______.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!