Affective cognition, operationally defined as reflecting an interface at which emotional and cognitive processes are integrated to generate behavior, includes a number of important subprocesses. Thus, the perception and recognition of emotional valence is vital for many tasks.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:When sunlight reaches the water; the water absorbs, lights of all colors in the white light and reflects only blue light. Thus, the earth from space appears blue. If the water absorbs all colors and reflects only yellow, then it would appear yellow.
Explanation:
Labeo = gills
Dolphin= pisces
Tadpole = hibernation
snake= internal fertilization
Eagle = aerial mode of life
Human = mammals
