1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stepan [7]
3 years ago
6

The first filial (F1) generation is the result of?

Biology
1 answer:
Andru [333]3 years ago
5 0

Answer:

F1 is the result of two cross-pollinated parent plants.

Explanation:

So basically, when you cross two true breeding parent plants, then the offspring is known as the F1 generation i believe.

You might be interested in
1. Which organism is able to cause an infection?
blondinia [14]
1) c- bacteria
2) d- break down dead organisms
5 0
4 years ago
Read 2 more answers
The most recent theory that upholds the Big Bang theory but suggests a sudden expansion after the bang is called what?
aev [14]
The answer would be Inflationary Theory.
4 0
3 years ago
Read 2 more answers
what type of muscle is found only in the heart. It is A) smooth muscle. B) cardiac muscle. C) skeletal muscle. D) voluntary musc
Studentka2010 [4]
Cardiac muscle is found in only the heart because the heart is also called cardiac and said to have cardiac muscle.the answer is b. hope this helps :) 
5 0
3 years ago
With regard to enzymes, what can be said to be the relationship between the substrate and the active site?
Rainbow [258]
They work like a lock and key. Each enzyme is designed to fit into a specific substrate. Well let me start by explaining what an enzyme is and then a subtrate. An enzyme is a protein that speeds up the chemical reaction in a living organism. An enzyme acts as a catalyst for specific chemical reactions, converting a specific set of reactants called substrates into specific products.
5 0
4 years ago
Read 2 more answers
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Other questions:
  • A function of another type of white blood cell is to
    15·2 answers
  • What is a loccolith?
    5·1 answer
  • To extract energy from carbohydrates, glucose is oxidized through several metabolic processes, resulting in end products of carb
    13·1 answer
  • What type of selection is occurring because baby's with low or high birth rates are less likely to survive?
    14·1 answer
  • What kind of egg do reptiles lay?
    6·1 answer
  • What is the function of the pons?
    7·1 answer
  • Chromosomes physically exchanging DNA, the formation of a chiasma. Is called what?
    11·1 answer
  • A new species uses photosynthesis to create energy. It must be pollinated by animals because it cannot move. Which
    14·2 answers
  • Food Web<br>please help​
    5·1 answer
  • What does this sprout need to grow into a healthy plant?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!