1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nekit [7.7K]
3 years ago
9

Hand signals of the 8 Essential life Functions​

Biology
1 answer:
oee [108]3 years ago
3 0
RRREGENTS

R-Respiration
R-Regulation
R-Reproduction

E-Excretion
G-Growth
N-Nutrition
T-Transport
S-Synthesis
You might be interested in
Smooth endoplasmic Reticulum has ribosomes attached to its surface. correct and rewrite the following.
solmaris [256]

Answer:

See below

Explanation:

The correct statements can be two of the following:

1) Rough Endoplasmic reticulum has ribosomes attached to it.

2) Smooth endoplasmic reticulum do not have ribosomes attached to it.

7 0
2 years ago
BRAINLIEST!! Do grasshoppers fly? Who wants 2 be my friend??
Feliz [49]

Answer:

grasshoppers skip through the air

Explanation:

i seen one do it

5 0
3 years ago
Read 2 more answers
how do engineers use models and earthquakes simulations to test designs for earthquake resistant buildings and structure
Oksana_A [137]

In Earthquake testing, the engineers are using the world largest shake tables to test new construction methods for buildings in the areas prone to the earthquake.

<u>Explanation:</u>

They believed that they have the devised a system to build the taller wood-frame buildings that can still safely withstand even very powerful tremors. To withstand the collapse, the buildings need to redistribute the forces that travel through them during a seismic event.

Shear wells, cross braces, diaphragm, and moment-resisting frame are the central reinforcing the building. Shear wells are the technology of the useful building. That helpful to transfer the earthquake forces.

6 0
3 years ago
The of a trna molecule determines the type of amino acid that bonds with the trna
Ymorist [56]
The correct answer is anticodon
3 0
3 years ago
How much has the earth warmed over the past 100 years
igomit [66]
It has warmed roughly 1.33°F.
5 0
3 years ago
Other questions:
  • Approximately how many female offspring are produced by 3-4 year old female ground squirrels? approximately how many female offs
    6·2 answers
  • Only ____ can cause alcohol to leave the body.
    5·1 answer
  • This is an organism or cell with two sets of chromosomes.
    9·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of these statements best explains how adaptation provides evidence to the scientific theory of evolution?
    9·1 answer
  • What is a jelly like fluid inside cells and organelles
    6·1 answer
  • Which process results in the embryo stage of a eukaryotic life cycle?
    10·1 answer
  • List six changes that take place if you smoke.
    5·1 answer
  • 3. A family rented a pontoon and cruised across the lake at 15 mph for 1.85 hours. How many
    5·1 answer
  • What does a cell need in order to get energy
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!