1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Minchanka [31]
4 years ago
11

How natural selection could lead to a change in allele frequency

Biology
2 answers:
love history [14]4 years ago
6 0

Natural selection can cause micro evolution, or a change in allele frequencies over time, with increase fitness alleles, that becoming more common in the population over generations.

<u>Explanation:</u>

NATURAL SELECTION:

Natural selection is refer to how the offspring organisms or particular genotype or phenotype steps into  the next generation. It  lead to changes in the allele frequency; natural selection can causes small number of evolution and  that causes allele frequencies changed  for long  time; and  the increases in  the allele becoming more common in the population over generation;  

ALLELE FREQUENCY:

Natural selection, genetic drift, mutations, genetic flow are the four factors that changes the population generation. This made the natural selection leads to change in the allele frequency.

Whitepunk [10]4 years ago
4 0

Answer:

Allele frequency can be described as a phenomenon which measure how common an allele is in a particular population. It tells about the genes which are richest in a gene pool and it also shows the genetic diversity in a population. Allele frequency is often expressed in percentages.

Natural selection tends to favour those organisms that are best adapted to live in an environment and which can withstand changes occurring in the ecosystem. If due to some circumstances, a trait becomes less useful to organisms in a population then by natural selection the allele frequency for those alleles will reduce with time. Similarly, the alleles which code for better genes for an environmental change will be increased due to the phenomenon of natural selection.

You might be interested in
46. Which of these is a pandemic?
yawa3891 [41]

Answer:

A

Explanation:

6 0
3 years ago
Plants take in the sun's energy by absorbing Select one: a. high-energy sugars. b. chlorophyll a. c. chlorophyll b. d. sunlight.
Sidana [21]

Answer:

the answer is D

Explanation:

the molecules of chlorophyll absorb the sun's energy in form if light

8 0
3 years ago
Plagiarism Global plagiarism Incremental plagiarism Patchwork plagiarism A. using bits and pieces of other sources and passing i
nikklg [1K]

Explanation:

1. Using bits and pieces of other sources and passing it off as one’s own work

Patchwork plagiarism

In patchwork plagiarism, an author uses bits from other people's works and pass it off as their own.

2. Passing off another person’s work as one’s own

Plagiarism

The act of passing off another person's work as one's own is called plagiarism. It is a very serious offence

3. Passing off the entire work of another person as one’s own

Global plagiarism

Global plagiarism is the complete passing off of another person's own.

4. When most of the work is one’s own, but uncited sources are used

Incremental plagiarism

Here an author fails to cite the sources where he/she obtains information from.

Learn more:

Plagiarism brainly.com/question/2623994

#learnwithBrainly

7 0
3 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Which of the following statement is true of a semi-conservative model of replication?
Ratling [72]
Answer - A
Semi-conservative model of replication involves the replication of DNA in all the familiar cells in such a way that each newly synthesized daughter cell contains a double helix with one new strand and one old strand.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Are all introduced species invasive?
    11·1 answer
  • Which choice describes DNA after replication has taken place
    8·1 answer
  • If an organism’s haploid number is 12, its diploid number is
    8·2 answers
  • How do unicellular organisms move around?
    11·1 answer
  • Which safe practice is part of using aseptic technique?using a safety shower to wash chemicals off skin and clothingwearing prot
    14·2 answers
  • if a red blood cell has solute of concentration of 0.9%, what would be the solute concentration of an isotonic solution
    7·1 answer
  • Stability returns to disrupted ecosystems because _____.
    8·2 answers
  • Every living things inherit what from their parents?
    8·1 answer
  • Phytochrome is a plant pigment protein that:
    6·1 answer
  • Imagine if a community ran out of their local land and water resources. What are things the community can do to provide its resi
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!