Answer:
the answer is D
Explanation:
the molecules of chlorophyll absorb the sun's energy in form if light
 
        
             
        
        
        
Explanation:
1. Using bits and pieces of other sources and passing it off as one’s own work 
Patchwork plagiarism 
In patchwork plagiarism, an author uses bits from other people's works and pass it off as their own. 
2. Passing off another person’s work as one’s own 
Plagiarism
The act of passing off another person's work as one's own is called plagiarism. It is a very serious offence
3. Passing off the entire work of another person as one’s own 
Global plagiarism
Global plagiarism is the complete passing off of another person's own. 
4. When most of the work is one’s own, but uncited sources are used
Incremental plagiarism
Here an author fails to cite the sources where he/she obtains information from. 
Learn more: 
Plagiarism brainly.com/question/2623994
#learnwithBrainly
 
        
             
        
        
        
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
 
        
             
        
        
        
Answer - A
Semi-conservative model of replication involves the replication of DNA in all the familiar cells in such a way that each newly synthesized daughter cell contains a double helix with one new strand and one old strand.