1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldi70 [24.7K]
4 years ago
7

Explain the energy transformation that occurs when a person exercises

Biology
1 answer:
ankoles [38]4 years ago
5 0
According to the First Law of Thermodynamics, energy is neither created nor destroyed. It is only being transferred from one form to another.

Everything that we do requires energy. Thus, following the first law stated above, we can say that there is an energy transformation when we exercise. These transformations are described as follow:

1. The food that you eat contains various forms of chemicals that are being stored in your body in the form of chemical energy.  When the food you eat is combined with oxygen, a chemical reaction takes place. During the process, chemical reaction bonds hold the atoms together are broken down to release energy. 

2. When the energy begins to put you into work, the chemical energy is now a potential energy is being transformed into kinetic energy.

3. Say the exercise involves riding a bike, the kinetic energy is now being transferred into the pedal in the form of mechanical energy.

4. Constant rubbing of the feet to the pedal may also transform some of the energy into heat, thus forming thermal energy. Likewise, your body may heat up during the exercise, that will also lead to thermal energy transformation.
You might be interested in
PlS HELP 30 POINTS FOR BRAINLIEST!!!!!!!!!!!!!!!!!!​
olga_2 [115]

Answer:

It's a little difficult to see the difference between the finch 1 and finch 2 population lines, but their trends should match those of the food. This answer is assuming the finch 1 population aligns with the seeds line and the finch two population lines up with the fruit line: <u>The finch 1 population has a beak adapted to eating seeds and the finch 2 population has a beak better adapted to eating fruit</u>

Explanation:

Since we are given data for both the food source and the finch population, the answer will most likely reflect that. Therefore eliminating choices A (disease) and C (feathers). Again, this answer is assuming the finch 1 population aligns with the seeds line and the finch two population lines up with the fruit line. The lines for the finch population will match with the availability of food, so less seeds mean less finch 1 and when the amount of seeds rise up you can see the population of finch 1 also rises.

3 0
3 years ago
50 POINTS! Please Help! 2-3 Sentences Per Question!
andrezito [222]
Well for the very last sentence it would be if any of the organs shut down it could seriously hurt someone or possibly even kill them if their brain,heart or some other important organ shuts down it could kill them.
There are other minor organs where if it shuts down it wouldn't really hurt the person too much. Sorry I couldn't help you with the other ones though.
3 0
3 years ago
What is the impact of a nonsence mutation?
aliya0001 [1]

Answer:b

Explanation:I believe it’s b I looked it up on google

6 0
4 years ago
Cheetahs can run very fast in short distances. to do this, they need to use the energy from the food they have eaten. which part
Stella [2.4K]

Answer:

electron transport chain

Explanation:

apex

3 0
3 years ago
Which of the following is NOT an example of nutrient reservoir
trapecia [35]

Answer:

D

Explanation:

The atmosphere is not an eycosystem

7 0
3 years ago
Other questions:
  • A magnet placed against the wall of a metal shed falls to the ground, where it attracts a nail. What is the most likely explanat
    15·2 answers
  • What is one example of a technology that Homo sapiens used to help them survive
    14·1 answer
  • I need help labeling this diagram please
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A patient has diabetes, a disease that causes high blood sugar levels. Which macromolecule will a dietician monitor most closely
    12·2 answers
  • I'm stuck can someone help me out please
    10·1 answer
  • What functional groups will be joined together if alanine and serine molecules combine to form a single molecule?
    8·1 answer
  • White short-horned cattle and black angus cattle have been crossed to produce offspring with superior beef and rapid grown quali
    8·1 answer
  • Which statement best describes the hydrosphere?
    10·1 answer
  • Where is fats and oil and protein digested ​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!