Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Due to the moon's location at a certain time of year
answer;
The most widespread nutritional deficiency worldwide is iron deficiency.
Iron deficiency can lead to anemia. This is a blood disorder that causes fatigue
symptoms;
Feeling tired or weak.
Having pale skin.
Having shortness of breath.
Sweating.
Being dizzy or feeling faint.
Rapid heartbeat.
Having headaches.
treatment;
Iron supplements taken by mouth.
Foods high in iron and foods that help your body absorb iron (like foods with Vitamin C).
Iron given through an intravenous (IV) infusion. (This is often a choice if you have chronic kidney disease, or CKD.)
Transfusions of red blood cells.
Women of childbearing age are the population with the most affected individuals, with an estimated 468 million being non-pregnant women.
Explanation:
Answer: D) The amount of air in a room never changes.
Explanation: Equilibrium is defined as the state in which the concentration of reactants and products is constant or the rate of forward direction is equal to the rate of backward direction.
a) The percentage of nitrogen gas in a room decreases steadily: the amount decreases that means the reaction is taking place in one direction and hence the reaction is not in equilibrium.
b) A blade of grass grows taller : the plant gets taller that means the reaction is taking place in one direction and hence the reaction is not in equilibrium.
c) The amount of water in a cup decreases as it evaporates: The amount of water is decreasing that means the reaction is taking place in one direction and hence the reaction is not in equilibrium.
d) The amount of air in a room never changes: the amount of air does not change as the amount of air leaving the room is same as that of the air entering the room and hence the reaction is in equilibrium.
Answer:
The thermal energy of the Earth remains from its formation and is continuously generated from radioactive decay of long-lived radionuclides in the Earths interior. The deeper the Earth layers the higher the temperature with the geothermal gradient of temperatures through the Earth’s crust on average as high as 25–30°C/km.
Explanation:
