1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
11

Which of these processes describes the effect Earth’s atmosphere has on Earth’s geosphere?

Biology
2 answers:
likoan [24]3 years ago
4 0

Answer:

The answer is B

Explanation:

 

gtnhenbr [62]3 years ago
3 0
It is D what di u think
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
How do flowering plants reproduce
tekilochka [14]
They reproduce by pollination.
4 0
3 years ago
Read 2 more answers
Match the following terms and definitions.
Annette [7]
The first statement matces with the last option - autosome
The second one goes with chromosome theory
Then, third is diploid
The next - haploid
Sixth - <span>linkage
Then  </span>x chromosome  and y <span>chromosome
Hope you still need the answer because this one is really helpful.
cheers!</span>
3 0
3 years ago
Both myoglobin and hemoglobin exhibit cooperative binding to oxygen. True or False
lys-0071 [83]

Answer:

False.

Explanation:

An Haemoglobin molecule  is made up of 4-polypeptides, with each of the polypeptide chain containing an haem group. These haem group can bind with one oxygen atom each.

T<u>he binding of the first oxygen atom  by the first haem group weakens the tertiary protein   structure  of  Quaternary structure  Hb, thus it makes it easier for the second Oxygen atom to bind faster, and the 3rd oxygen very fast and the 4th oxygen atom the fastest.These accelerated binding of the oxygen atoms, facilitated by the first binding O2, is called cooperative binding.It aids oxygen binding capacity and tranport functions  of Hb,</u>

<u />

<u>Myoglobin is an oxygen storage protein in  muscles, and not oxygen carrying molecule, It releases  stored O2 only in condition of low oxygen supply</u>.It has   one haem group in its molecule.Therefore its structural features can  not  carry out  cooperative binding.

6 0
3 years ago
Crude oil is turned into usable forms of energy in a ______.
iren [92.7K]

Answer: C) Turbine

Explanation: Crude oil is turned into usable forms of energey by a Combustion Turbine. Hope this helped!  

5 0
2 years ago
Other questions:
  • Why colloidal solution show tyndall effect
    14·1 answer
  • Pyruvatic acids are formed during which stage of cellular respiration?
    14·2 answers
  • What is the purpose of the comb? - science
    9·2 answers
  • Climate changes several times a day. <br> TRUE or FALSE
    8·2 answers
  • What is the bond angle between the hydrogen atoms in the ammonia molecule
    7·1 answer
  • Three phases of interphase and describe an activity unique to each phase
    13·1 answer
  • The situation in which allele frequency in the gene pool of a population remain constant is called
    15·2 answers
  • What Two<br> surround and enclose the chloroplasts.
    9·2 answers
  • Giovanni and his family go on a trip and they drive over a mountain range. Giovanni wonders how the rock they see as they drive
    8·1 answer
  • Information abut traits is stored in the cell nuclues in a molecule called
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!