2. A
3. D (got cut off but the others don’t seem right)
4. D
Hopefully these are correct
The cell cycle is an ordered series of events involving cell growth and cell division that produces two new daughter cells. Cells on the path to cell division proceed through a series of precisely timed and carefully regulated stages of growth, DNA replication, and division that produces two identical (clone) cells.
sorry if it is wrong
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The amount of water reabsorbed during the formation of urine can be changed by hormones, enabling the creation of either concentrated or diluted urine. The duct serves this purpose.
In heating, ventilation, and air conditioning (HVAC), air is delivered and removed by ducts, which are conduits or passageways. Examples of the necessary airflows include supply air, return air, and exhaust air. As part of the supply air, ducts frequently deliver ventilation air as well. As a result, air ducts are one way to guarantee both thermal comfort and adequate interior air quality. The brain releases a substance called antidiuretic hormone (ADH), which makes the kidneys release less water and reduces the volume of urine generated. The body makes less pee when its ADH level is high. A low
Learn more about The duct here.
brainly.com/question/28209437
#SPJ4
