Answer:
The body uses the food as energy (and proteins for bones).
Explanation:
ree
Answer:
Swelling
Explanation:
As the body tries to heal itself, the tissues may swell and become inflamed, causing a cast to become tight and uncomfortable.
<span>inanimate non-living alive dead</span>
Answer:
<u>Biofilms are</u> defined as complex communities of microorganisms that grow embedded in a self-produced polymeric organic matrix and adhered to a living or inert surface, and that can present a single microbial species or a range of different species
Explanation:
The bacteria that form the biofilm are in what is called sessile form, exhibiting a phenotype different from those of the same cells in unicellular or free form (planktonic form) with respect to the growth rate and gene transcription (Donlan, 2002 ).
<u>
The formation</u> of biofilms is an adaptive strategy of microorganisms, since growth in biofilm offers four important advantages: (I) protects microorganisms from the action of adverse agents, (II) increases the availability of nutrients for their growth, (III) facilitates the use of water, reducing the possibility of dehydration and (IV) enables the transfer of genetic material (DNA). All of these circumstances can increase your survival capabilities. As a consequence, <u>the usual methods of disinfection or the use of antibiotics are often ineffective against biofilm bacteria</u>.
In addition to the risk of contamination, the development of biofilms can interfere with different processes and cause damage to the equipment. In drinking water systems the formation of biofilms can obstruct the pipes reducing their speed and transport capacity causing an increase in energy consumption. The formation of biofilm in heat exchangers and cooling towers can reduce heat transfer and as a consequence its efficiency in the process. The formation of persistent biofilms on metal surfaces can cause corrosion due to acid production by bacteria.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
