1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
14

Breads and other whole grain foods are composed of very large polysaccharide molecules which contain hydrogen, oxygen, and which

other element?
a)carbon
b)iron
c)nitrogen
Biology
2 answers:
kakasveta [241]3 years ago
6 0
A is the answer to this question
Rudiy273 years ago
4 0
Carbon (helpful hint- all of the macromolecules contain carbon. these are carbs, fats (lipids), proteins, and nucleic acids. Carbon defines it being an organic molecule.)
You might be interested in
HELP ASAP BRAINLYIST
serg [7]

Answer:

C:ocean plates collide w/ the continetal plates

8 0
2 years ago
as the submersible approaches the twilight zone (300m deep), what changes in light and temperature occur?
Sunny_sXe [5.5K]

In the twilight zone, the temperature and the light conditions change. The initial 200 meters of the ocean as considered as the open ocean. There is availability of light and thriving temperature there. Butt below that, in the 'deep ocean'. The availability of light decreases and as we go further down, the light no longer reaches those parts of the ocean. Moreover, the temperatures plummet down to almost freezing conditions. In addition to this, the pressure is much more higher in the deep ocean.

4 0
3 years ago
Do the six kingdoms each have a purpose in the real world today like it did back then.
Nuetrik [128]
I’m assuming the six kingdoms of life, but yes they do have a very large purpose for providing characteristics to bacteria, animals, fungi, humans, etc.
3 0
3 years ago
Carbon dioxide is released when which of the following phenomena occur?
dimaraw [331]

Answer:

burning fossil fuels

Explanation:

5 0
3 years ago
An experiment uses two groups of mice with 20 individuals in each group. Both groups are fed the same amount of water and food e
Anna007 [38]

Answer:

constants.

Explanation:

Climate-controlled room are almost indoor and are kept with stable temperatures and also with stable humidity levels.

<u>In biological experiments, it used to establish constant parameters like temperature, humidity, exposure to different things, growth of organisms and etc.</u>

These rooms provide better shelf life and thus better results.

6 0
3 years ago
Other questions:
  • Changes in the genetic make-up are normally _____ to the organism.
    15·2 answers
  • Which energy source does not originate from the sun?
    8·1 answer
  • Consider this pathway: epinephrine → g protein-coupled receptor → g protein → adenylyl cyclase → camp. identify the second messe
    8·1 answer
  • How are the male penguin trying to attract gloria?
    5·2 answers
  • Describe the<br>Inter relation<br>bla<br>living and living thing in a tabular form​
    15·1 answer
  • Which key morphological feature is used to classify organisims as mammals?
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • During this period, the uterus shrinks back to its original state in a process called ____________ .
    9·1 answer
  • An alligator can run 1000 meters in 200 seconds what is the speed
    6·1 answer
  • A bog formed where there was once a pond. Which three statements describe how the pond turned into the bog?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!