1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marshall27 [118]
3 years ago
10

Which force of attraction helps move water up through plants

Biology
1 answer:
jasenka [17]3 years ago
7 0
Capillary action helps water move through plants
You might be interested in
What type of evolution is illustrated by many species developing from one common ancestral species?
kifflom [539]
My Answer: Vestigial organs

Why?: " Vestigial organs are physical structures that were fully developed and functional in an ancestral group of organisms but are reduced and unused in the later species."

Hope I helped! :D
3 0
3 years ago
The diagram shows a food chain.
topjm [15]

Answer:

D,Producer

Explanation:

Hope this helps!

5 0
3 years ago
Read 2 more answers
Can someone help me please
alexandr402 [8]

D)

Because a scientific theory is something that has been proven over the trials of many tests


Hope that helps :)

5 0
3 years ago
Read 2 more answers
What do scientists use to look at astronomical bodies?
love history [14]
D <span> microscopes  hope it helps </span>
7 0
3 years ago
Which of the following statements is not based on climate change denial
Doss [256]

The correct answer is A.The climate is changing rapidly but it will be too expensive to fix.

Explanation:

Climate change involves important long-term changes in climate patterns as well as other features on land and bodies of water. This phenomenon has occurred naturally during the history of Earth; however, nowadays climate change has accelerated due to human activities that produce global warming and therefore the increase in temperatures and changes in climate.

Despite this, some deny climate change, which is known as climate change denial; this includes stating climate change does not exist, it is an exaggeration or a hoax, or considering it is the result of natural cycles. According to this, the only statement that is not based on climate change denial is "The climate is changing rapidly but it will be too expensive to fix" because in this statement the speaker recognizes climate change is real and considers it is a serious issue that might be difficult to solve.

6 0
2 years ago
Other questions:
  • When interpreting correlations, it is important to remember that a?
    15·1 answer
  • PLS HELP!!!
    13·2 answers
  • Scientific thinking: how can scientists assess the health risks of trans fats
    15·1 answer
  • If you were preparing nutrient agar at home and did not have an autoclave, what could you use to sterilize the nutrient agar?
    5·1 answer
  • The defining equation for calorimetry is __________.
    6·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Griffiths (1928) mixed heat-killed "S" bacteria with "R" bacteria and injected a mouse with both types of bacteria. As a result,
    12·1 answer
  • A man with blood type B marries a woman with blood type A . Their first child has blood type 0 . Use a Punnett square to predict
    9·2 answers
  • Can someone please help me with my science research I kind of need help in a few things that I listed, I’m currently working on
    6·1 answer
  • PLEASE HELP PLSSS I need just answer fast
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!