1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
2 years ago
14

What two plant traits did Luther Burbank try to combine in his crosses?

Biology
1 answer:
Anit [1.1K]2 years ago
8 0
<span>He tried to combine the disease resistance of one plant with the food-producing capacity of another.
</span>
You might be interested in
In cells, the p53 gene is crucial in maintaining cell health. Identify a problem that will occur if a mutation arises in a cell'
zaharov [31]

Answer:A) The cell will lose it’s ability to repair DNA

Explanation:

I just took the test and it’s telling me the correct answer as I go

5 0
2 years ago
Someone Plz Help me :)
Sati [7]

Answer:

part a

A= Tt

B=tt

part b

offspring a

genotype= TT&Tt, phenotype=tongue rolling

offspring b

genotype=Tt phenotype= tongue rolling & genotype tt phenotype= unable to roll tongue

4 0
2 years ago
The digestive process involves two main types of digestion. Identify each type and explain how each works to break down food. In
Igoryamba

Answer:

<em>Digestive Processes The processes of digestion include six activities: ingestion, propulsion, mechanical or physical digestion, chemical digestion, absorption, and defecation. The first of these processes, ingestion, refers to the entry of food into the alimentary canal through the mouth.</em>

Explanation: :)

5 0
1 year ago
How does natural selection favor an individual that can detect deceitful communicators? see section 50.5 ( page 1062) ?
Gnesinka [82]

This is comparable to the impression of the 'sneaky' males in the side-blotched lizard. Natural section favor an individual by the detector or sensor will sustain less cost and increase an advantage and gain over others incapable to distinguish the deceitfulness. 

4 0
3 years ago
Which wavelengths of light drive the highest rates of photosynthesis? Select the two best answers.
Lilit [14]

Answer:

  • 400-450 nm
  • 550-700 nm

Explanation:

Chlorophyll pigments (mainly chlorophyll a and b) absorb the red and blue spectrum of visible light in the electromagnetic spectrum for photosynthesis. This is why leaves appear green (and occasionally orange) because this visible light portion is not absorbed. The blue light absorbed by leaves ranges between 400 – 450 nm while the red light ranges between 500 nm and 700 nm.

8 0
2 years ago
Other questions:
  • Describe what is happening in each stage and what each stage looks like: Prophase Prometaphase Metaphase Anaphase Telophase Cyto
    13·2 answers
  • Which of these is not a form of potential energy?
    5·1 answer
  • What does it mean to draw a conclusion?​
    15·1 answer
  • In a particular population, over the course of several dozen generations, an adenine was replaced by a guanine at a particular n
    10·1 answer
  • 10 POINTS
    5·2 answers
  • 1. The diagram below represents part of Earth's latitude-longitude system
    9·1 answer
  • A habitat is:
    5·2 answers
  • What is an example of a passive transport across the cell memberane
    8·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What is the medical term for inflammation of the nose and throat
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!