Your left chamber of your heart pumps the blood away and the right brings it in
White blood cells also called leukocytes are the cells that help fight infection causing protection of the body against a disease or foreign substance. An example is a leukemia which then creates a large number of abnormal white blood cells.
The RNA bases pair as:
Uracil will pair with Adenine
Guanine will pair with Cytosine
Adenine will pair with Thymine
Cytosine will pair with Guanine
The answer is D, electrons;protons
Answer:
TTAACGCTAGCGAGCATGGCC
Explanation:
A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.