1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NNADVOKAT [17]
3 years ago
6

The __ regulates body temperature, thirst, appetite, and water balance.

Biology
1 answer:
lidiya [134]3 years ago
4 0

The correct answer is B. Hypothalamus.

Explanation

The hypothalamus is a part of the brain that is located below the thalamus, it is an area of the brain where several and very important homeostatic regulatory functions of the organism are integrated. Its main function is to link the autonomic nervous system with the endocrine system. Other functions are to control body temperature, control thirst and urine production (water balance in the body), control food intake, control uterine contractions and milk ejection in mammals, the coordination of the nervous system Autonomous, which affects smooth muscle and cardiac activity, influences behavior and expression of emotions. Therefore, the correct answer is B. Hypothalamus

You might be interested in
which part of the heart pumps oxygen-rich blood away from the heart? left atrium right atrium left ventricle right ventricle
Nesterboy [21]
Your left chamber of your heart pumps the blood away and the right brings it in
6 0
3 years ago
What cardiovascular disease creates a large number of abnormal white blood cells?
qaws [65]
White blood cells also called leukocytes are the cells that help fight infection causing protection of the body against a disease or foreign substance. An example is a leukemia which then creates a large number of abnormal white blood cells.
6 0
3 years ago
When messenger rna is being made the rna base always pairs with the base in dna?
ruslelena [56]
The RNA bases pair as:
Uracil will pair with Adenine
Guanine will pair with Cytosine
Adenine will pair with Thymine
Cytosine will pair with Guanine
5 0
3 years ago
Anions have more _____ than _____.
ra1l [238]
The answer is D, electrons;protons
3 0
3 years ago
Read 2 more answers
Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG
k0ka [10]

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

7 0
4 years ago
Other questions:
  • Tigers and humans are both classified into which kingdom within the Eukaryota domain?
    15·1 answer
  • In one species of bird, there are three varieties of feather color. What is this an example of?
    16·1 answer
  • Scientists believe that the direction birds go when migrating is guided in part by _____. i) the stars in the night sky ii) the
    8·2 answers
  • Patients who have experienced even minor-appearing head injuries should be suspected of having a brain injury, especially if the
    15·1 answer
  • During recombination ________________________.
    8·1 answer
  • Can muscles contract if there isn't any free calcium in the cell?
    14·1 answer
  • Why is smooth ER considered smooth?
    12·1 answer
  • How did Egypt’s natural boarders protect the country from invaders
    5·1 answer
  • The energy pyramid show below represents a valley ecosystem. Which transfer of energy shown below is most likely? Remember, ener
    15·1 answer
  • Explain mechanism of blood clotting in humans​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!