A eukaryotic cell is classified this way if it B. contains a nucleus. In biology the definition of eukaryotic is "having a true nucleus" which is how to depict a prokaryotic cell from a eukaryotic cell.

5 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

What is the basic unit of a nucleic acid and what is it made of?

riadik2000 [5.3K]

The basic repeating unit of nucleic acids are known as nucleotides. A nucleotide consists of three distinct chemical groups, a 5-carbon sugar (ribose or deoxyribose), a nitrogen-rich base - (cytosine (C), guanine (G), adenine (A), thymine (T) in DNA or uracil (U) instead of T (in RNA), and phosphate.

4 0

3 years ago

Read 2 more answers