1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julsineya [31]
3 years ago
5

Select all that apply.

Biology
1 answer:
m_a_m_a [10]3 years ago
8 0

The purposes of mitosis are :

cell renewal

repair of injuries

asexual reproduction

growth of organisms

Explanation:

The purpose of mitosis is cell restoration, growth, and asexual reproduction, while the persistence of meiosis is the generation of gametes for sexual reproduction. Mitosis is a single nuclear distribution that appears in two nuclei that are regularly partitioned into two new daughter cells.


You might be interested in
Which of these is a function of
Mnenie [13.5K]
C
As the cap helps it to move around while the tail prevents enzymes from eating the RNA
8 0
1 year ago
PLZZZZZZ HELPPP how do we obtain energy from wind PLZ WRITE A PARAGRAPH ABOUT ITTT PLEASEEEEE
sladkih [1.3K]

Explanation:

Wind energy, or wind power, is created using a wind turbine, a device that channels the power of the wind to generate electricity. The wind blows the blades of the turbine, which are attached to a rotor. The rotor then spins a generator to create electricity . Wind energy is a renewable energy source that is clean and has very few environmental challenges. Wind power actually starts with the Sun. In order for the wind to blow, the Sun first heats up a section of land along with the air above it. That hot air rises since a given volume of hot air is lighter than the same volume of cold air. Cooler air then rushes in to fill the void left by that hot air and voila: a gust of wind. The Office of Energy Efficiency and Renewable Energy describes a wind turbine as “the opposite of a fan.” Simply stated, the turbine takes the energy in that wind and converts it into electricity. So how does it do that? First, the wind applies pressure on the long slender blades, usually 2 or 3 of them, causing them to spin, much like the wind pushes a sailboat along its path through the water. The spinning blades then cause the rotor, or the conical cap on the turbine, and an internal shaft to spin as well at somewhere around 30 – 60 revolutions per minute. The ultimate goal is to spin an assembly of magnets in a generator which will, well, generate voltage in a coil of wire thanks to electromagnetic induction. Generators require faster revolutions, however, so a gear box typically connects this lower speed shaft to a higher speed shaft by increasing the spin rate to around 1000 to 1800 revolutions per minute. These gear boxes are costly as well as heavy, so engineers are looking to design more “direct-drive” generators that can work at the lower speeds.

5 0
2 years ago
Read 2 more answers
What is true about the efficiency of energy transfer in an ecosystem?
Schach [20]
<span> Very inefficient. Almost 90% of all energy is lost between trophic levels. That is why larger animals need to eat more, because less energy is being consumed. 
</span>
8 0
2 years ago
Why do you think that some vaccines, such as the flu vaccine, need to be given every year?
DochEvi [55]

Answer:

Because flu viruses evolve so quickly, last year's vaccine may not protect you from this year's viruses. New flu vaccines are released every year to keep up with rapidly adapting flu viruses.

5 0
3 years ago
Read 2 more answers
Do saturated fats have single carbon-to-carbon bonds or at least one double carbon-to-carbon bond?
Sladkaya [172]

Answer:

Saturated fats contain only single carbon bonds in the carbon chain

Explanation:

6 0
3 years ago
Other questions:
  • what do the similarities between the skeletal structures of these three species most likely indicate about their evolutionary hi
    15·1 answer
  • Help me please
    15·1 answer
  • The genetic information that is passed from a parent to its offspring is found in
    9·2 answers
  • Help me thank u !!!!!!
    12·2 answers
  • What could be done to return the environment of the peppered moth to its original state?
    5·2 answers
  • Look at the map below. The mountains in the Pinnacles National Monument and the mountains at Tejon Pass were once located next t
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What are homologous chromosomes?
    7·2 answers
  • How does Earth's mass affect life on the planet?​
    6·1 answer
  • What is the rate at which the body expends energy for daily maintenance activities, like keeping the body alive and organ functi
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!