1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shutvik [7]
3 years ago
11

If you increase the surface area of a rock, how will it affect the rate at which it weathers?

Biology
2 answers:
Morgarella [4.7K]3 years ago
7 0
The answer  is D. it weather more slowly because it is less prone to be carried away by nature. <span />
Mkey [24]3 years ago
6 0

Answer:

B is the answer

Explanation:

You might be interested in
Explain the rock cycle by describing how an igneous rock can become a sedimentary rock, then a metamorphic rock, and then an ign
Paraphin [41]
An igneous rock can be formed from cooled magma. The igneous rock can become sedimentary if it is broken down by wind or water. The sedimentary rock can become metamorphic if it becomes buried in the earth, where pressure and heat would turn it into a metamorphic rock. The metamorphic rock can then become an igneous rock by melting underground and turning into magma, flowing out of a volcano, and cooling. 
5 0
3 years ago
Which is least likely to push a species towards extinction?
lyudmila [28]

Answer:

Species that are broadly distributed are less likely to go extinct than those that occupy a small area or whose habitat is disjointed.

3 0
3 years ago
Some archaea (single cell organisms) live in extremely salty water such as the Great Salt Lake or the Dead Sea. Most types of ce
kaheart [24]
Halophiles are extremophiles that thrive in environments with very high concentrations of salt. <span>Halophiles prevent this loss of water by increasing the internal osmolarity of the cell by accumulating </span>osmoprotectants<span> or by the selective uptake of potassium ions. Hope this helps.</span>
<span />
8 0
3 years ago
Read 2 more answers
How will I use the scientific method to become a better medical professional
Lena [83]
It helps you follow procedures accurately in order to get higher, more accurate results and become a better medical professional
6 0
3 years ago
The hollow area left in a rock from a former organism is a(n):
Alex
What remains left is called a <span>Fossil</span>
6 0
3 years ago
Other questions:
  • The diagram helow 82 A student attempted to find the volume of piece of wood using water in it represents a graduated cylinder w
    6·1 answer
  • Within any large animal population, there is _______ a variety of traits. And between different animal populations, there is ___
    11·1 answer
  • Types of organisms that are photosynthetic primary producers are plants and what else ?
    9·2 answers
  • Correctly describe pH of a solution?
    10·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following hereditary conditions is characterized by lack of insulin production?
    11·2 answers
  • Why was the Selective Service Act an important step toward winning world war 1 ?
    8·1 answer
  • Estuaries contain a mixture of what?
    7·1 answer
  • When you are exposed to sunlight for a long time, your skin, which otherwise appears normal, gets heavily tanned. What could be
    11·2 answers
  • A trait such as having a crooked thumb is produced by a(n)
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!