1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rufina [12.5K]
3 years ago
15

HIV is a virus that attacks your immune system. What kind of problems can arise if your immune system is being attacked?

Biology
1 answer:
bagirrra123 [75]3 years ago
7 0
Your body will not be able to fight off disease causing pathogens.
You might be interested in
The relationship between the bacterium xenorhabdus nematophila and its nematode host is called
netineya [11]

Answer:

specific mutualism

Explanation:

The bacterium is contained in a vesicle of the foregut of an infective juvenile stage soil nematode. Once the nematode finds and enters an insect host, the bacterium in released into the hemocoel of the insect.

4 0
3 years ago
How big is the universe
Valentin [98]

nobody realy know but we so know that it is alwas getting bigger

4 0
4 years ago
Read 2 more answers
Dab most likely inhibits which reaction?a. phosphorylation of glucose. phosphorolysis of glycogen. export of lactate from cellsd
Pie

Dab most likely inhibits phosphorolysis of glycogen reaction.

<h3>What is phosphorolysis?</h3>
  • Inorganic phosphate acts as the attacking group during phosphorolysis, which is the cleavage of a molecule.
  • It's comparable to hydrolysis.
  • A reversible process akin to hydrolysis where phosphoric acid behaves like water and produces phosphate as a byproduct.
  • It's comparable to hydrolysis.
  • Glycogen phosphorylase, which catalyzes the assault of inorganic phosphate on the terminal glycosyl residue at the nonreducing end of a glycogen molecule, is an example of this.
  • The difference is that while reactions involving hydrolysis use water to split larger molecules into smaller ones, reactions involving phosphorolysis use phosphate to achieve the same result.
  • The primary enzyme in utilizing the glycogen reserves in the muscle and liver is known as glycogen phosphorylase.
  • It catalyzes the sequential phosphorolysis of glycogen to liberate glucose-1-phosphate.

Learn more about phosphorolysis here:

brainly.com/question/21882419

#SPJ4

4 0
2 years ago
The auditory hallucinations experienced by people with schizophrenia are most closely linked with the activation of areas in whi
andreev551 [17]

Answer: temporal lobes

Explanation:

Auditory hallucinations can be defined as the false perceptions related to sound. People affected with the schizophrenia are affected by the auditory hallucinations. The sound or noises are not real in origin these are the outcomes of person's weak mental make up or illness. The auditory hallucinations are caused because of neural abnormality that originate in the left temporal lobes.  

7 0
3 years ago
Write a short note on the activities that cause Air pollution.?
arlik [135]

Answer:

Fuel combustion from motor vehicles (e.g. cars and heavy duty vehicles)

Heat and power generation (e.g. oil and coal power plants and boilers)

Industrial facilities (e.g. manufacturing factories, mines, and oil refineries)

Municipal and agricultural waste sites and waste incineration/burning

Residential cooking, heating, and lighting with polluting fuels

4 0
3 years ago
Other questions:
  • One potential cause of valve dysfunction is rupture of the chordae tendineae why would this lead to valve dysfunction
    7·1 answer
  • Which of the following are not examples of levers?
    6·2 answers
  • One thing required for diffusion is a
    6·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • As we move across the periodic table of elements, certain trends are evident. The placement of individual elements in the
    6·1 answer
  • Planting selectmaterial in low quality? please answer my question​
    10·1 answer
  • WILL MARK BRAINLIET IF CORRECT
    10·2 answers
  • Which of the following strands are complementary DNA sequences?<br> Choose 1 answer:
    9·1 answer
  • Which of the following would best support a claim that most people feel hopeful about the future of the economy? (5 points) A ta
    9·1 answer
  • Is the onion skin composed of one or many cells
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!