1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
5

Distinguish between anabolism and catabolism?

Biology
2 answers:
IgorLugansk [536]3 years ago
7 0
Anabolism creates molecules the body needs for functionality and it uses energy in the process. Catabolism, on the other hand, breaks down complex molecules and releases energy which is available for the body to use
Karo-lina-s [1.5K]3 years ago
7 0

Explanation:

Anabolism creates molecules the body needs for functionality and it uses energy in the process. Catabolism, on the other hand, breaks down complex molecules and releases energy which is available for the body to use.

You might be interested in
Which two generalizations can be made based on what you know about cycles of matter in a closed system?
Black_prince [1.1K]

Answer: The correct answer is option 3) The amount of matter within the system remains the same and 5) The cycle has a well-defined starting and stopping point.

A closed system can be defined as a system in which there is the only exchange of energy with the surrounding, while no exchange of matter takes place.  

In a closed system, the cycle has a well-defined starting and stopping point.

Therefore, the two generalizations which can be made for cycles of matter in a closed system are option 1) and 5)

4 0
3 years ago
Read 2 more answers
Please can anyone check if the paragraph about gaseous exchange correct?
Nikolay [14]
I don’t really know sorry
5 0
3 years ago
The two kinds of cells are Prokaryotes and Eukaryotes. How are they
fredd [130]
Eukaryotes have nucleus and protaryotes have plant calls that’s the difference
8 0
3 years ago
Help help help help​
Dafna11 [192]

I believe the answer is D

I hope this helps!

Please mark Brainliest!

8 0
3 years ago
Read 2 more answers
Given the sequence ATGGCGAATCACGTCACTTGA
Marina86 [1]

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

4 0
3 years ago
Other questions:
  • _____ have highly developed olfactory receptors. honey bees mollusks sharks eagles
    11·2 answers
  • Which of the following is NOT a major branch of domain Bacteria?
    7·1 answer
  • Where does cellular respiration begin
    6·2 answers
  • What prompts the prokaryote to stop replication and undergo cell division?
    6·1 answer
  • What role does phytoplankton Play in the food web of many aquatic ecosystems
    13·2 answers
  • Found on the capillary walls, a _______ breaks down the chylomicrons and removes triglyceride, breaking it into free fatty acids
    15·2 answers
  • According to the law of conservation of mass: One gram of potassium is mixed with four grams of oxygen. They undergo a chemical
    10·1 answer
  • HELPP
    10·1 answer
  • The largest contributor to global greenhouse gas emissions is?
    9·1 answer
  • What kind of traits do brown beetle have
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!