1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natka813 [3]
3 years ago
5

Implanting an electrode that supplies a weak electrical current to specific brain areas is called _____. It is useful in the tre

atment of _____
Biology
1 answer:
hodyreva [135]3 years ago
7 0

Answer:

Deep Brain Stimulation (DBS)

Depression, Uncoordinated body movements such as in Parkinson's disease

Explanation:

Deep brain stimulation is a surgical procedure in which a device that sends electrical impulses to the brain by means of lead wires connected to electrodes placed in the specific areas of the brain, is implanted in the body, typically the chest region.

This surgical procedure is usually required to treat diseases in which there is irregular and improper nervous stimulation of the brain resulting in various nervous disorders such as irregular muscle movements as in Parkinson's disease as well as depression.

The impulses sent from the stimulator device to the electrodes in the brain through the wires, serves to stabilize and normalize nerve signals sent to the brain.

You might be interested in
A protein that spans the phospholipid bilayer one or more times is
Leona [35]

Answer:

a transmembrane protein

Explanation:

A transmembrane protein spans the phospholipid bilayer one or more times. they are made of amphiphilic phospholipids: phospholipids with a hydrophilic phosphate head and a hydrophobic tail with two fatty acid chains.

7 0
3 years ago
What is the best way to fight foodborne illness? check food for microbial contamination using a magnifying glass. buy only steri
Basile [38]
I think the answer is to throw away all uneaten and excess food...etc
5 0
3 years ago
In the phylum cnidaria, jellies are members of the ________ clade and corals are members of the ________ clade.
dybincka [34]
The answer is scyphozoan; anthozoan.

In the phylum cnidaria, jellies are members of the <u>scyphozoan</u> clade and corals are members of the <u>anthozoan</u> clade. Cnidaria is a phylum of aquatic invertebrates. It includes sea anemones, corals, jellyfish, box jellies, Hydra, etc. Corals are the members of class Anthozoa and jellies are members of class Scyphozoa.
7 0
3 years ago
How much does fast forward surgical teams get paid?
SVETLANKA909090 [29]
The answer is a very good amount.....
4 0
3 years ago
BRAINLIEST!! According to embryology, why do fish and birds have a common ancestor?
Blizzard [7]

Answer:

Both fish and bird embryos exhibit gill slits and a tail.

Explanation:

According to embryology, all vertebrates exhibit similar traits and structures at their embryonic stage. It becomes very difficult to differentiate between the embryos of a fish, and that of a bird, or embryo of a fish, and a human. These traits, however, disappear, as the case may be, as the embryo develops into an adult. For example, in the case of the embryo of a fish, and a bird, both shows gills slits at their respective embryonic stage. However, the gill slits in fish develop into gills, whereas in the case of birds, it disappears as the embryo develops into an adult.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Which statement best illustrates a biotic or an abiotic factor that is often found in a city park?
    5·2 answers
  • The process of cell division results in *
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • "line of best fit" for a scatterplot must pass through at least _____ of the data points in the data set.
    13·1 answer
  • What supply of oxygen exists in the body at any one time?
    12·1 answer
  • Which discovery did Gregor Mendel make?
    10·2 answers
  • What protein does this DNA code for
    10·1 answer
  • What are microorganisms
    7·1 answer
  • Helppp this is due in 10 minutes!!!! (34 points) How, and why would some continent have more A-Allele than other continents?
    15·2 answers
  • Porque razones considera que es importante la genética y en que caso se puede utilizar o aplicar ?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!