Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
D,E,G is the correct answer
The hereditary form of hypertension is detected when the adrenal gland produces too much aldosterone.
<u>Explanation:</u>
Hypertension is an important risk factor for several cardiovascular disease. If prolonged it damages the blood vessels causing malfunctioning of the heart, kidneys and brain. Hypertension can be caused due to various genetic or environmental factors.
There are cases where familial hypertension are detected. This is caused due to the mutation in a single gene which is passed on to the generations where even in young age the children are seen affected with hypertension.
This in medical terms is termed as familial hyperaldosteronism type II. This is occurred due to the mutation in CLCN2 gene. It tends to produce too much of aldosterone hormone which causes high blood pressure.
The land and the aquatic are the two types of global food webs