1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ronch [10]
3 years ago
5

What organisms are found in the climax community

Biology
1 answer:
tresset_1 [31]3 years ago
7 0
Weed and grass.......
You might be interested in
Which structure is present in bacteria but not in a virus?
saveliy_v [14]

Answer:cell membrane

3 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Can some one plz help me on this question its hard :( ill give brainliest
Doss [256]
D,E,G is the correct answer
8 0
3 years ago
Which of the following would indicate that a person has developed a hereditary form of hypertension
Salsk061 [2.6K]

The hereditary form of hypertension is detected when the adrenal gland produces too much aldosterone.

<u>Explanation:</u>

Hypertension is an important risk factor for several cardiovascular disease. If prolonged it damages the blood vessels causing malfunctioning of the heart, kidneys and brain. Hypertension can be caused due to various genetic or environmental factors.

There are cases where familial hypertension are detected. This is caused due to the mutation in a single gene which is passed on to the generations where even in young age the children are seen affected with hypertension.

This in medical terms is termed as familial hyperaldosteronism type II. This is occurred due to the mutation in CLCN2 gene. It tends to produce too much of aldosterone hormone which causes high blood pressure.

5 0
3 years ago
Identify the two types of global food food webs and describe how they are connected
SVETLANKA909090 [29]
The land and the aquatic are the two types of global food webs
4 0
3 years ago
Other questions:
  • Forensic scientists can match missing persons and their families by matching maternal DNA to the missing individual. Which type
    6·2 answers
  • Âwhat is the term for chronic and degenerative liver disease that causes injury to the hepatocytes
    7·1 answer
  • A disease of the blood characterized by overproduction of leukocytes is called
    7·1 answer
  • In a very small population of birds, assume there are two types of alleles that control feather color. 5 out of 20 total alleles
    6·1 answer
  • Which of the following is not a tissue type?
    9·2 answers
  • The illegal blood alcohol concentration for drivers younger than 21 is ____%
    8·1 answer
  • When excess glucose is present, it is used to form glycogen through a process called?
    6·1 answer
  • ///////WILL MARK BRAINLIEST///////////NEED HELP ASAP////////////////////////////
    8·1 answer
  • Imagine that a man is scratched by his cat. A phagocyte near the scratch site recognizes and engulfs a bacterium. Shortly therea
    8·1 answer
  • Which statement describes what happens to the carbon dioxide produced in cellular respiration?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!