1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
3 years ago
9

Placental mammals devope

Biology
2 answers:
LenKa [72]3 years ago
8 0

Answer:

C

Explanation:

disa [49]3 years ago
5 0

Answer:

C

Explanation:

Placentas are inside of the mother's body

You might be interested in
Which characteristic do euglenoids and algae share
Svetradugi [14.3K]
Euglenoids <span>are unicellular protists commonly found in fresh </span>water.They don not have a cell<span> wall, despite that, a protein rich </span>cell membrane called pellicle is present in Euglenoids.
Whereas,<span>Algae are eukaryotic organisms comprising of no roots, stems, or leaves but they filled with chlorophyll and other pigments to carry out the process of photosynthesis. Similar to </span>Euglenoids, they<span> occur most frequently in water, specifically in plankton.
</span>Hence,
Euglenoids and algae share a common characteristic,that is both are autotrophs. They <span>produce complex organic compounds from simple substances present in their surroundings, by the use of energy from sun-light or inorganic chemical reactions.</span>
6 0
3 years ago
Read 2 more answers
Unwanted dumping of chemicals has caused pollution in a particular region, leading to a decrease in the number of insects. Blueb
snow_tiger [21]
It could have a decrease of the food chain and not just effect animals but people
6 0
3 years ago
Read 2 more answers
Bony Fish (bass etc.) and marine mammals (like dolphins) evolved some similar adaptations for survival in aquatic environments.
xeze [42]

Answer:

Convergent evolution

Explanation:

Convergent evolution is a type of evolution of similar features and/or structures between organisms that are not phylogenetically related. This type of evolution is known to create analogous structures/organs that exhibit similar or the same functions but were not present in the last common ancestor of these taxa. An example of analogous structures (and therefore also of convergent evolution) are the wings of bats and of insects (e.g., butterflies). Conversely, divergent evolution is a type of evolution where species phylogenetically related, i.e., species that share a common ancestor, evolve and accumulate differences over time.

6 0
3 years ago
As nevide was listening to the radio, an old song that he had not heard for a very long time began to play. to his amazement, no
Elodia [21]
Elaborative rehearsal is a memory system that includes contemplating the significance of the term to be recalled, instead of essentially rehashing the word to yourself again and again. For instance, you have to recall the expression "neuron."
4 0
3 years ago
The work output of a machine divided by the work input is the ____ of the machine
Artist 52 [7]
The work output of a machine divided by the work input is the resistance of the machine
3 0
3 years ago
Other questions:
  • A doctor was delivering a presentation about the perils of using illegal intravenous drugs to a group of drug addicts at a rehab
    6·1 answer
  • The most recent ice age ended about
    7·2 answers
  • Which substances would complete the equation that
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If this fossil is 65 million years old, what could this fossil suggest about organisms alive today?
    10·2 answers
  • What would happen to a compass if Earth's magnetic field were to invert?
    13·1 answer
  • Please asap help i am not even sure if my ans is correct but help me out
    9·2 answers
  • The start of outer space is called​
    12·2 answers
  • 2. Some organisms are more likely to survive because they
    7·1 answer
  • Label electron micrograph of B lymphocyte.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!