Answer:
Natural selection
Explanation:
Natural selection is the main mechanism by which populations adapt and change over time to survive in their environment. Individuals in a population exhibit different gene variants or 'alleles' (i.e., individuals exhibit genetic variation). Some of these alleles are associated with phenotypic traits better suited to the environment than others. Natural selection can change allele frequencies in the population, increasing the frequency of the alleles associated with higher fitness, i.e., those alleles associated with lower mortality and the most offspring in a particular environment. Over time, these advantageous alleles become more common in the population. In consequence, natural selection can be considered as a statement on the expected value of allele frequencies under resampling from one generation to the next.
Answer:
Greater on Jupiter
Explanation:
Gravity depends on mass. Jupiter has more mass than Earth so its gravity is two and a half times greater. Therefore a person will weigh more on Jupiter.
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
It would mean that the organisms rely on each other for survival.
Hope this helps (:
The shape of a protein allows it to perform its particular job.