Which blood type contains the carbohydrate n-acetylgalactosamine?

Biology

1 answer:

MissTica2 years ago

8 0

Blood type A.

Hope this helps! :)

You might be interested in

PLEASE HELP 50 POINTS BRAINLIST

klasskru [66]

The answer is D.

This is because in all the other examples both males, the squares, and females, the circles, inherit freckles. But I’m example D. only males, the squares, inherit freckles. Hope this helps!!

3 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved