Answer:
C. H+ ions do not accumulate inside the thylakoid, so ATP synthase makes too little ATP.
Explanation:
Plant withering refers to the virtual death of plant cells due to lack of food. During the light-dependent reactions of photosynthesis, ATP needed for the synthesis of sugar (food) is created in the thylakoid membrane of the CHLOROPLAST of plant cells.
In the light-dependent reaction, hydrogen ions (H+) builds up/accumulate in the thylakoid lumen to create an electrochemical or proton gradient i.e. a difference in the concentration of H+ ions across the membrane. The hydrogen ions passes through a protein complex called ATP synthase, which forms ATP from ADP (by adding phosphate group), from the energy generated by the electrochemical gradient formed as a result of hydrogen in (H+) build up.
Hence, a plant that possess leaky membrane due to the cold temperature will likely wither because H+ ions are not able to accumulate inside the thylakoid causing a proton gradient, so ATP synthase makes too little ATP.
Answer:
Yes, viruses are super small. It is also smaller than bacteria. So you wouldn't notice anything.
Answer:
The Arctic tern is a medium-sized bird around 33–36 cm (13–14 in) from the tip of its beak to the tip of its tail. The wingspan is 76–85 cm (30–33 in). The weight is 86–127 g (3.0–4.5 oz.).
Explanation:
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Number 4 should be mitosis
