1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
12

A patient mangled his left hand in machinery requiring amputation at the wrist. the wound has healed and the patient is fitted w

ith an artificial hand. the device has a molded socket, flexible elbow hinges and triceps pad. a total of 30 minutes was spent training the patient to use the prosthesis. what codes are reported for the prosthesis, training and diagnosis?
Biology
1 answer:
SSSSS [86.1K]3 years ago
6 0

The correct answer is 97761 * 2, L6050, Z44.8, Z89.11.  

In the CPT index when one looks for Prosthetics/Training, then one is directed towards 97761. The code is repeated for every 15 minutes. As 30 minutes are spent in training, so 2 units are reported. In the HCPCS level II codebook when one looks for Disarticulation/Wrist prosthesis, one is directed towards codes L6050, L6055. On the basis of description, the prosthesis is reported with code L6050.  

In the alphabetic index of ICD-10-CM, when one looks for fitting/device NOS/prosthetic (external), then one is directed towards the code Z44.8. In the index when one looks for the absence of organ or part (complete or partial)/wrist and hand (acquired) then one is referred towards the code Z89.11.  


You might be interested in
Propose some possible explanations for the large volume of noncoding DNA in the human genome.
Elden [556K]

Answer: Non coding  DNA do not contains instructions for proteins synthesis.

They are needed to

1. determine the point  of  attachments of transcription factors, and

2,they are also needed to control the transcriptions of genetic code from DNA to mRNA during mechanism of transcription.

Explanation:

7 0
3 years ago
Free 19 points -w- hurry and claim em before their gone
irina1246 [14]

Answer:

ok

Explanation:

6 0
3 years ago
Read 2 more answers
What is natural selections affect on allele frequencies
enot [183]

Answer:

Natural selection also affects allele frequency. If an allele confers a phenotype that enables an individual to better survive or have more offspring, the frequency of that allele will increase.

Explanation:

that's it

8 0
3 years ago
What of the following correctly identifies some of the molecules produced from the glucose synthesised by photosynthesis?
Yuliya22 [10]

Answer:

plant life use a system known as photosynthesis to make meals.

at some stage in photosynthesis, plant life entice mild strength with their leaves.

plant life use the strength of the solar to extrade water and carbon dioxide right into a sugar known as glucose.

glucose is utilized by plant life for strength and make different materials like cellulose and starch.

cellulose is utilized in constructing mobileular walls. starch is saved in seeds and different plant components as a meals source.

Explanation:

5 0
2 years ago
7. What is the speed of the sound in air of 250 C temperatures
Nina [5.8K]

Answer:

i think is c

Explanation:

5 0
3 years ago
Other questions:
  • In evolutionary history, the first animals to successfully invade land from the sea were ___________________, an animal with a h
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • In many tissues, one of the earliest responses to cellular injury is a rapid increase in the level of enzymes involved in the pe
    10·1 answer
  • Biomolecule that is energy storage unit
    6·1 answer
  • Shortly after implantation ________. the embryo gastrulates (within 3 days) maternal blood sinuses bathe the inner cell mass myo
    12·1 answer
  • Can someone help me with this please
    6·1 answer
  • This tree contains example of several food Chains .bird live in the tree and eat insects they find within the branches .insects
    12·1 answer
  • PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .!
    13·1 answer
  • Which term is defined as the concept of believing one's culture is better than
    10·1 answer
  • Are Lima beans living or non living? Please explain your opinion.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!