1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Law Incorporation [45]
3 years ago
10

What is one rock from the mars

Biology
2 answers:
Novay_Z [31]3 years ago
8 0

Answer:

A Mars rock???

Explanation:

netineya [11]3 years ago
8 0

Answer:

The martian crust is made mostly of basaltic igneous rock composed mostly of feldspar and pyroxene.

Hope this helps please give me brainliest!

God bless

You might be interested in
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
In the process of diffusion what is required for a molecule to move into or out of the cell
Marysya12 [62]
I'm not sure if this helps but I think that oxygen moves into and carbon dioxide leaves it.
5 0
4 years ago
Convection currents move in the ?
Schach [20]

magma drive plate tectonics

7 0
4 years ago
To what element does Thorium-230 (atomic number-90) decay when it emits an alpha particle (42He)? a. 22688Ra c. 22886Rn b. 23090
abruzzese [7]

Answer:

Option A

Explanation:

Thorium-230 decays to Radium-226 also emitting an \alpha  particle.

<u><em>The reaction is as follows:</em></u>

^{230}Th   =>   ^{226} Ra + ^{4} He (Alpha-particle)

5 0
3 years ago
Which region of Earth’s crust experiences the least amount of pressure? crust mantle outer core inner core
Ne4ueva [31]

The correct answer is the crust.  

The crust is present above the mantle and is the hard outer shell of the Earth. The crust is 0 to 32 km in thickness. The densest type of crust is oceanic crust with the density of 3.0 g/cm3. The mantle is the layer below the crust and above the core.  

The mantle exhibits an average density of 4.5 g/cm3. The density increases with depth as the pressure increases. The outer core exhibits a density between the range of 10 g/cm3 to 12.3 g per cm3 and the density of the inner core is about 12 g/cm3. Showing that the inner core exhibits the highest pressure.  


8 0
3 years ago
Read 2 more answers
Other questions:
  • When does a mutation have the most impact on allele frequency?
    6·2 answers
  • Which is a limitation of a scientific model?
    9·1 answer
  • What is the main advantage of the amniotic egg?
    10·1 answer
  • Match each phrase with the correct answer. Group of answer choices Organism in a lichen that provides protection [ Choose ] Orga
    8·1 answer
  • Helppppppppppppppppppppppppp
    11·2 answers
  • Grace is the editor of her school newspaper. Which feature of a word processing program would she use to make her changes visibl
    9·2 answers
  • What is a benefit of genetic engineering?
    13·2 answers
  • 18. In Hypotonic solution, the cell .. *<br> gets bigger<br> gets smaller<br> stays the same
    12·1 answer
  • Yo who gonna help me today
    14·2 answers
  • 1. According to Kelleher, what is the first step in understanding the phenomenon of color?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!