1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
givi [52]
3 years ago
15

Why does osmosis not cause submerged water plants to swell up and burst?

Biology
1 answer:
Trava [24]3 years ago
3 0
Because it creates ATP, or active transport against the concentration gradient.
You might be interested in
Injuries may damage the nerves of any motor or sensory division of the PNS. In which PNS subdivision would a nerve injury be the
Harrizon [31]

Answer:

In the Sympathetic Nervous System PNS subdivision in which nerve injury would be the most dangerous for life.

Explanation:

In the Sympathetic Nervous System PNS subdivision in which nerve injury would be the most dangerous for life.

 It is important for survival to fight or respond to flight because it controls the physiological reaction to a risk or danger and this flight and flight response is activated by sympathetic nervous system. This system is a part of automatic nervous system and operated by various interconnected  neuron

4 0
3 years ago
What is the light and porous material at the center of bone.
Ostrovityanka [42]

Answer:

Spongy or cancellous tissue – the porous, honeycombed material found inside most bones, which allows the bone to be strong yet lightweight.

5 0
2 years ago
In the human body, which of the following organs connects to the sensory organs through nerves
Diano4ka-milaya [45]

Answer:

Are there any choices to choose from?

Explanation:

5 0
2 years ago
Oxygen is required to conduct cellular respiration? true/false
Leya [2.2K]
<span>Respiration is the process that is utilized by all living cells in order to create energy. The process is usually carried out in the presence of oxygen (aerobic respiration) but can also take place in the absence of oxygen (anaerobic respiration). Therefore the answer in this case is false.</span><span />
3 0
3 years ago
Precipitation clouds are observed at a distance of about 700 miles to the west of a city. The clouds are seen moving eastwards a
7nadin3 [17]
Distance = speed x time Distance = 20 x 24 Distance = 480 miles The clouds will have travelled 480 miles. The clouds will still have 700 - 480 = 220 miles before they reach the city. The weather will be dry.
4 0
3 years ago
Other questions:
  • Sandy is a vegan and is at risk of failing to meet her daily iron needs. what would be a good food for her to eat to obtain iron
    6·2 answers
  • What is a term that means the ability of leukocytes to move in and out of blood vessels in order to reach sites of inflammation
    15·1 answer
  • The carbon cycle activity sheet
    14·2 answers
  • When a____ air mass moves toward a warmer air mass, it causes a cold front. The ____ air rises, leaving ____ temperatures in the
    14·2 answers
  • What are the polymers for proteins carbohydrates lipids and nucleic acids?
    9·1 answer
  • What eats common king snake and what eats it
    5·2 answers
  • HELP QUICK PLZZZ
    11·1 answer
  • Which of these is harmed by an ectoparasite in a parasitic relationship?
    14·2 answers
  • The most abundant of the four major classes of biomolecules, which also include proteins, lipids, and nucleic acids. They fill n
    6·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!