1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ratling [72]
3 years ago
10

A typical organ is made up of many different kinds of cells and tissues. true or false

Biology
1 answer:
mr Goodwill [35]3 years ago
6 0
False, a typical organ is made up of one specific type of cells and tissues
You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What organ lies on the outer wall of the testes within the scrotum?
shutvik [7]
The answer is the epididymis. It is a contracted, tightly-coiled tube linking back of the testicles to the deferent duct (vas deferens). The epididymis contains three parts and these are the head, body, and tail. The head of the epididymis is positioned on larger pole of testis. It stocks sperm for maturation.
6 0
3 years ago
True or false carbohydrates also make up part of the cell membrane
timofeeve [1]
True because carbohydrates are in the cell membrane.
6 0
2 years ago
Which part of a modern firearm has the same function as the lock on a muzzleloader? safety trigger action barrel?
AveGali [126]
<span>On a modern firearm, the feature that functions like the lock on a muzzleloader is the safety. The safety was added to modern guns to prevent them from accidentally firing, although it should be noted that a safety is a man-made mechanical device which makes it subject to failure at times.</span>
7 0
2 years ago
All forms of life on earth are linked together in relationships involving _____.
Snezhnost [94]
The answer is energy i am pretty sure
7 0
3 years ago
Other questions:
  • A testable hypothesis could be formed from which question
    15·2 answers
  • Giving BRAINLIST if you help fast!!
    10·2 answers
  • 50 POINTS!!! For anyone who wants to do an experiment because I got plenty of other projects to work on xD. It would be super he
    13·2 answers
  • What is parthenogenesis? give an example
    7·1 answer
  • What is apical growth​
    13·2 answers
  • Finding that two species have similar DNA is an example of studying which characteristic to determine evolutionary relationships
    11·1 answer
  • What is the best conclusion based on this data?
    10·2 answers
  • What is the formula for computation<br> of the magnification power of the microscope?
    14·1 answer
  • 5. To properly measure 20 ml of water, what must be at the 20 ml mark of the graduated<br> cylinder?
    10·1 answer
  • The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!