1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
8

What statement best describes what happens to a substrate after it bonds to an enzyme?

Biology
2 answers:
Andrew [12]3 years ago
8 0
The enzyme catalyzes (speeds up) the rate at which the substrate is broken down.
Kisachek [45]3 years ago
7 0

Answer:

The enzyme/substrate complex is aligned to improve access during a reaction

Explanation:

Enzymes are characterized by being catalysts that increase the speed of the reaction. Enzymes decrease activation energy for enzyme-substrate complex formation. The substrate binds to the active site of the enzyme for the formation of the enzyme-substrate complex. The product is then released and the enzyme will be available again for another reaction.

You might be interested in
Which of the following is an interaction in which one organism benefits and the other is unaffected?
Lena [83]
I think it’s Commensalism since it is an interaction in which one individual benefits while the other is neither helped nor harmed.
5 0
2 years ago
Read 2 more answers
Why does having a genetically diverse population make a species more likely to survive a change to the environment?
Eddi Din [679]
Genetic adaptability is very important to the survival and adaptability of any specie. This is because, in a diverse population, the possibility of finding individuals with the right genetic adaptability to the changing environment is higher, the population will have more possible adaptations. 
4 0
3 years ago
Read 2 more answers
Hemoglobin is a protein that binds to oxygen. It is only produced by red blood cells and it allows blood to transport oxygen thr
Ksenya-84 [330]

The statements are true.

Hemoglobin (Hb), is the oxygen-transport metalloprotein which contains iron in the centre of its structure. This metalloprotein is found in the red blood cells (erythrocytes). The function of hemoglobin is to transport the oxygen through the blood carries from the lungs to the rest of the tissues. Oxygen is necessary for the aerobic respiration in order to provide energy for the functions of the organism (metabolism).


7 0
3 years ago
How does the wavelength of a G-note sound wave compare to the wavelength of an A-note sound wave? A. The G-note's wavelength is
ratelena [41]

Answer:

The G-note's wavelength is longer.

Explanation:

As we know that

The relationship between frequency, wavelength and the speed given as

Speed = Frequency x Wavelength

V= f λ

For constant speed, if wavelength increase then the frequency of the sound get reduce.

The wavelength of the A-note sound waves is smaller than the G -notes sound waves.

Therefore the answer of the given question will be A.

7 0
3 years ago
If this site was made by students shouldn't it be a non-profit type thing?
Fiesta28 [93]
Yes and no, yes because they need to learn how the industry works and how you gain and lose profit, no because they are too young and can’t understand the concept of running a site.
8 0
3 years ago
Other questions:
  • Which of these is an example of a population in a desert ecosystem?
    7·2 answers
  • An antibiotic that attacks the LPS layer would be expected to have a broad spectrum of activity, effective against Gram negative
    8·1 answer
  • The second messenger camp is synthesized by the enzyme _____.
    10·1 answer
  • C) Why are vaccines important in preventing infections of more dangerous viruses?
    15·1 answer
  • What things are recycled during photosynthesis and respiration?
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Providing examples explain how sexual reproduction in plants has evolved to become less dependent on water.
    15·1 answer
  • An example of a density dependent limiting factor is...
    7·1 answer
  • What does a secondary level consumer eat?
    13·1 answer
  • What is another way nitrogen is added back into the atmosphere BESIDES animal waste, but is too unreliable to count on?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!