1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eddi Din [679]
3 years ago
11

Which statement best describes the relationship of photosynthesis and onorgy?

Biology
2 answers:
yan [13]3 years ago
7 0

The process of photosynthesis is onergy storing bocause the process converts light onorgy into chemical energy,

leonid [27]3 years ago
6 0
The correct answer is the first one,
The process of photosynthesis is energy storing because the process converts light energy into chemical energy,
which is stored in the bonds of glucose.

This is because photosynthesis is a storing process.
You might be interested in
In angiosperms, a zygote and endosperm form as a result of
maks197457 [2]
The answer of the first question is double fertilization !!! I don't get the second question so.... comment if you have that question !!!
4 0
2 years ago
What is the most powerful respiratory stimulant in a healthy person? what is the most powerful respiratory stimulant in a health
Lelu [443]
The correct answer is the arterial blood carbon oxide level. 
Arterial blood test measures oxygen and carbon dioxide levels in the blood. It also measures the body's acid-base level, which is normally balanced when an individual is healthy. The normal range for carbon dioxide is 23 to 29 mEq/L. 
4 0
3 years ago
Read 2 more answers
What does the body do during the exhaustion phase of the GAS model? It prepares to fight danger or run from it. It identifies th
ki77a [65]
It prepares to fight danger or run from it. It identifies the primary source of danger.

8 0
3 years ago
Read 2 more answers
Partial or complete loss of hearing (deafness) can be caused by damage to the _____. i) axons of the neurons associated with eac
neonofarm [45]
Partial or complete loss of hearing can be caused by damage to the; I, II, and III, that is, the axons of the neurons associated with each hair cell that carry information to the brain, hair cells in the cochlea and also the tympanic membrane. Hearing impairment, deafness or hearing loss is the inability to hear things, either totally or partially. This may be caused by injury or diseases that damages the parts responsible for hearing process. 
3 0
3 years ago
Once a woman attains puberty, her overuse mature and release one egg per ovarian cycle. Which hormone stimulates this event?
ale4655 [162]
Follicle-stimulating hormone (FSH)
8 0
3 years ago
Other questions:
  • Which labels would correctly model photosynthesis?​
    12·2 answers
  • N which structures of green plants does photosynthesis primarily take place?
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The poison dart frog can have bright green, red, blue, or yellow skin that secretes a poisonous substance when it feels threaten
    14·2 answers
  • What element do nucleotides possess but proteins do not​
    7·1 answer
  • What happens to the half-life of a radioactive substance as it decays?
    14·1 answer
  • Rocks in and on the Earth are constantly changing because of both physical and chemical processes. The continual change in rocks
    12·2 answers
  • All of the following affect the climate of an area except
    5·2 answers
  • Marine dinoflagellates and seaweed are members of the ___________ kingdom.
    14·2 answers
  • A trait has two alleles, represented by p and q. If p = 0.22, what is g?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!