1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rodikova [14]
3 years ago
5

all of the following are reasons why friendships are more highly valued by older people in late adulthood than family relationsh

ips expect?
Biology
1 answer:
Leviafan [203]3 years ago
3 0

There are no choices but the reason why we tend to value friends as we grow older is because these are bonds that we create on our own.  These are people who have been there for us throughout our lives. They are our link with the outside world since they are not our family members.  The longer we are friends with others, the deeper that bond becomes.

You might be interested in
How does a habitat impact the survival odds of an organism?
Nimfa-mama [501]

Answer is B

Increase the odds by creating relationships among organisms.

5 0
3 years ago
Read 2 more answers
Select the correct answer.
lana66690 [7]

Answer:

B

Explanation:

4 0
3 years ago
Where are the chromosomes of most organisms located?
kaheart [24]
Enclosed within the nucleolus of the cell.
6 0
3 years ago
Read 2 more answers
What is the difference between active and passive cellular transport?
s344n2d4d5 [400]
The difference between active and passive cellular transport is that active transport requires energy for the ions and molecules to move across the cell membrane whereas passive cellular transport does not an energy input.
7 0
3 years ago
The S phase in the cell cycle is the
BARSIC [14]
It is the part of the cell cycle in which the dna is replicated! vote me brainliest please :) ❤️
4 0
3 years ago
Other questions:
  • How many unit operations are involved when in the process of converting green coffee beans into brewed coffee?
    8·1 answer
  • What can you do to make sure you conduct a lab activity in a safe manner. Give 3 examples​
    11·2 answers
  • How does a runner acquire an oxygen debt ?
    10·1 answer
  • How do enzymes interact only with specific substrates?
    8·2 answers
  • How do physical characteristics of organisms support the theory of evolution?
    6·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Students in a health class are studying the circulatory system. They learn that normal red blood cells transport oxygen in the b
    10·1 answer
  • Cytosine mKes up 38% of the nucleotide in a sample of DNA from an organism. Approximately, what percentage of the nucleotides in
    5·1 answer
  • 2 characteristics of bisexual flowers​
    6·1 answer
  • Some people have their gall bladder surgically removed to the formation of gall stones. Describe the function of the gall bladde
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!