1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLEGan [10]
3 years ago
15

With what we know about the isthmus across the Bering Strait, why are most people of North America thought of as having European

ancestry rather than Native American?
due to Native Americans leaving for warmer climates
due to intermarriages between the populations
due to Native populations settled only near the Bering Strait
due to Europeans overpowering native populations
Geography
1 answer:
UkoKoshka [18]3 years ago
4 0

Answer:

Among the options shown here:

Due to Europeans overpowering native populations.

Explanation:

You might be interested in
Someone help i need the answers pleaseee it’s important for a project also please answer in your own words I’ll mark you as brai
kirill115 [55]

Answer:

hehe sorry sorry sorry

Explanation:

sorry sorry sorry

7 0
3 years ago
Read 2 more answers
All of the following are signs of an economic crisis except
Lilit [14]
Is there any answer choices?
6 0
3 years ago
Read 2 more answers
The vertical succession of sandstone, shale, and limestone from the bottom of a rock column to the top, such as that found in Ca
yarga [219]

Answer:

transgression

Explanation:

In this case we will have deeper sea sediments (shales and limestones) being deposited on top of continentally-derived beach sediments (sand). This forms a sequence (from bottom to top) of: sand to shale to limestone. This is an indication of marine transgression

7 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Substances that can eat through or dissolve metal storage tanks and equipment are called
zubka84 [21]
They are called CORROSIVE
7 0
3 years ago
Other questions:
  • Triangle TRS is rotated about point X, resulting in triangle BAC. Triangle T R S is rotated about point X to form triangle B A C
    13·1 answer
  • Is it biotic or abiotic?<br> Sea turtle
    12·2 answers
  • Under what circumstances did John Locke think it would be acceptable for the people to overthrow the government? It is never acc
    14·1 answer
  • Why are these planets so different? To answer this, we must start with an understanding of the processes that cause planetary su
    14·2 answers
  • Which of the following is NOT an example of a federalist state?
    15·1 answer
  • How does energy get into the apple in the first place?
    9·2 answers
  • Some scientists believe that race is __________.
    15·2 answers
  • What explains the unchanging language of Iceland?
    6·1 answer
  • Чому більшість річки впадають до атлантичного океану?
    9·1 answer
  • Explain the Uses of satellite photograph in meteorological studies​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!